NCBI CCDS banner
PubMed Entrez Gene BLAST OMIM
  

CCDS
Home
FTP
Process
Releases & Statistics

Collaborators
EBI
HGNC
MGI
NCBI

Contact Us
email CCDS

Genome Displays

Ensembl
NCBI
UCSC
VEGA

Related Resources
Gene
HomoloGene
MANE
RefSeq

Report for CCDS28970.1 (current version)

CCDS Status Species Chrom. Gene CCDS Release NCBI Annotation Release Ensembl Annotation Release Links
28970.1 Public Mus musculus 17 Dpy30 23 108 98 CCDS HistoryNCBI Gene:66310Re-query CCDS DB by CCDS ID:28970.1Re-query CCDS DB by GeneID:66310See the combined annotation on chromosome 17 in Sequence Viewer

Public since: CCDS release 2, NCBI annotation release 36.1, Ensembl annotation release 39

Review status: Reviewed (by RefSeq and Havana)

Sequence IDs included in CCDS 28970.1

Original Current Source Nucleotide ID Protein ID Status in CCDS Seq. Status Links
Original member Current member EBI ENSMUST00000112571.4 ENSMUSP00000108190.3 Accepted alive Link to Ensembl Transcript Viewer:ENSMUST00000112571.4Link to Ensembl Protein Viewer:ENSMUSP00000108190.3Re-query CCDS DB by Nucleotide ID:ENSMUST00000112571Re-query CCDS DB by Protein ID:ENSMUSP00000108190
Original member Current member EBI ENSMUST00000164832.8 ENSMUSP00000126702.1 Accepted alive Link to Ensembl Transcript Viewer:ENSMUST00000164832.8Link to Ensembl Protein Viewer:ENSMUSP00000126702.1Re-query CCDS DB by Nucleotide ID:ENSMUST00000164832Re-query CCDS DB by Protein ID:ENSMUSP00000126702
Original member Current member EBI ENSMUST00000233581.1 ENSMUSP00000156795.1 Accepted alive Link to Ensembl Transcript Viewer:ENSMUST00000233581.1Link to Ensembl Protein Viewer:ENSMUSP00000156795.1Re-query CCDS DB by Nucleotide ID:ENSMUST00000233581Re-query CCDS DB by Protein ID:ENSMUSP00000156795
Original member Current member EBI ENSMUST00000232687.1 ENSMUSP00000156830.1 Accepted alive Link to Ensembl Transcript Viewer:ENSMUST00000232687.1Link to Ensembl Protein Viewer:ENSMUSP00000156830.1Re-query CCDS DB by Nucleotide ID:ENSMUST00000232687Re-query CCDS DB by Protein ID:ENSMUSP00000156830
Original member Current member NCBI NM_001146222.1 NP_001139694.1 Accepted alive Link to Nucleotide Sequence:NM_001146222.1Link to Protein Sequence:NP_001139694.1Re-query CCDS DB by Nucleotide ID:NM_001146222Re-query CCDS DB by Protein ID:NP_001139694Link to BLAST:NP_001139694.1
Original member Current member NCBI NM_001146223.1 NP_001139695.1 Accepted alive Link to Nucleotide Sequence:NM_001146223.1Link to Protein Sequence:NP_001139695.1Re-query CCDS DB by Nucleotide ID:NM_001146223Re-query CCDS DB by Protein ID:NP_001139695Link to BLAST:NP_001139695.1
Original member Current member NCBI NM_001146224.1 NP_001139696.1 Accepted alive Link to Nucleotide Sequence:NM_001146224.1Link to Protein Sequence:NP_001139696.1Re-query CCDS DB by Nucleotide ID:NM_001146224Re-query CCDS DB by Protein ID:NP_001139696Link to BLAST:NP_001139696.1
Original member Current member NCBI NM_024428.4 NP_077746.3 Accepted alive Link to Nucleotide Sequence:NM_024428.4Link to Protein Sequence:NP_077746.3Re-query CCDS DB by Nucleotide ID:NM_024428Re-query CCDS DB by Protein ID:NP_077746Link to BLAST:NP_077746.3

RefSeq Length Related UniProtKB/SwissProt Length Identity Gaps Mismatches
NP_001139694.1 99 Q99LT0 99 100% 0 0
NP_001139695.1 99 Q99LT0 99 100% 0 0
NP_001139696.1 99 Q99LT0 99 100% 0 0
NP_077746.3 99 Q99LT0 99 100% 0 0

Chromosomal Locations for CCDS 28970.1

Assembly GRCm38.p6 (GCF_000001635.26)

On '-' strand of Chromosome 17 (NC_000083.6)
Genome Browser links: Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 17Link to Ensembl Genome Browser on chromosome 17See the combined annotation on chromosome 17 in Sequence Viewer

Chromosome Start Stop Links
17 74299752 74299824 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 17Link to Ensembl Genome Browser on chromosome 17
17 74307720 74307862 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 17Link to Ensembl Genome Browser on chromosome 17
17 74315902 74315949 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 17Link to Ensembl Genome Browser on chromosome 17
17 74316044 74316079 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 17Link to Ensembl Genome Browser on chromosome 17

CCDS Sequence Data
Blue highlighting indicates alternating exons.
Red highlighting indicates amino acids encoded across a splice junction.
 
Mouse over the nucleotide or protein sequence below and click on the highlighted codon or residue to select the pair.

Nucleotide Sequence (300 nt):
ATGGAGTCGGAGCAGATGCTGGAGGGACAGACACAGGTTGCAGAAAACCCTCACTCTGAGTACGGGCTCA
CA
GACAGCGTTGAGAGAATAGTCGAAAATGAGAAGATTAATGCAGAAAAGTCATCGAAACAGAAGGTGGA
T
CTACAGTCCTTGCCCACCCGTGCCTACCTGGACCAGACAGTTGTGCCTATCTTATTACAGGGACTTGCT
GTG
CTTGCCAAGGAAAGACCACCAAATCCCATCGAGTTCCTAGCATCTTATCTTTTAAAAAACAAGGCGC
AG
TTTGAAGATCGAAATTGA


Translation (99 aa):
MESEQMLEGQTQVAENPHSEYGLTDSVERIVENEKINAEKSSKQKVDLQSLPTRAYLDQTVVPILLQGLA
V
LAKE
RPPNPIEFLASYLLKNKAQFEDRN



Links Key
 Links to:   History report
  BLAST report
  Entrez Gene
  Nucleotide report
  Protein report
 Re-query CCDS DB by:   CCDS ID
  Gene ID
  Nucleotide ID
  Protein ID
 Genome Browser Links:   Ensembl Genome Browser
  NCBI Sequence Viewer
  UCSC Genome Browser
  VEGA Genome Browser