Warning: The NCBI web site requires JavaScript to function. more...
An official website of the United States government
The .gov means it's official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you're on a federal government site.
The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.
cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.3kb resulted in an average insert size of 1.7kb. This is a non-normalized primary library (normalized library is NIH_MGC_432) and was constructed by Express Genomics (Frederick, MD) for the (http://mgc.nci.nih.gov/) Mammalian Gene Collection.
Nucleotide
Your browsing activity is empty.
Activity recording is turned off.
Turn recording back on