Warning: The NCBI web site requires JavaScript to function. more...
An official website of the United States government
The .gov means it's official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you're on a federal government site.
The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.
Modification of pBluescript II KS(+) [Stratagene] vector to accommodate cDNA produced with the T-trimmed protocol (Construction of uni-directionally cloned cDNA libraries from messenger RNA for improved 3' end DNA sequencing by Glenn Fu, et al. U.S. Patent # 6,387,624). Cut pBluescript II KS(+) with NotI and EcoRI. Ligate in double stranded adaptor containing BsgI and BamHI sites [5'ggccgcgtgcagccccggatccgaaaaaaag] [5'aattctttttttcggatccggggctgcacgc]
Nucleotide
Your browsing activity is empty.
Activity recording is turned off.
Turn recording back on