Warning: The NCBI web site requires JavaScript to function. more...
An official website of the United States government
The .gov means it's official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you're on a federal government site.
The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.
RNA obtained from brain tissue of 8 wk old animal. Tissues were snap-frozen and kept at -80C before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25kb resulted in an average insert size of 1.7 kb. This primary library is a normalized (primary library is NIH_MGC_254) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library
Nucleotide
Your browsing activity is empty.
Activity recording is turned off.
Turn recording back on