NIH_MGC_252

Warning: The NCBI web site requires JavaScript to function. more...

Result Filters

Organism: Rattus norvegicus (Norway rat)
cellular organisms; Eukaryota; Opisthokonta; Metazoa; Eumetazoa; Bilateria; Deuterostomia; Chordata; Craniata; Vertebrata; Gnathostomata; Teleostomi; Euteleostomi; Sarcopterygii; Dipnotetrapodomorpha; Tetrapoda; Amniota; Mammalia; Theria; Eutheria; Boreoeutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus

Attributes

tissue	Ovary, strain - Norway Line3. Age8 weeks. Tissue was snap-frozen adn transferred in -70C. RNAse free for the entire procedure
lab host	DH10B TonA
tissue	ovary
vector	pExpress1
v_type	plasmid
re_1	NotI
re_2	NotI

Description: RNA obtained from female overies animals at 8 wk old. Tissues were snap-frozen and kept at -80C for two days before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25kb resulted in an average insert size of 1.7kb. This primary library is not normalized (normalized library is NIH_MGC_252) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library