Warning: The NCBI web site requires JavaScript to function. more...
An official website of the United States government
The .gov means it's official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you're on a federal government site.
The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.
Approximately 1mg total RNA was extracted from 100 adult mouse whole eyes. A directionally cloned cDNA library in the pSPORT1 vector (Invitrogen) was constructed at Bioserve Biotechnology (Laurel MD) essentially following the protocols of the SuperScript Plasmid System full details of which are contained in the manufacturer's Instruction manual (http://www.lifetech.com/). First strand synthesis was carried out using a Not I primer-adapter [5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)15-3']. cDNA was cloned in Not I/Sal I sites. EST analysis was performed on the unamplified library at the NIH Intramural Sequencing Center (NISC).
Nucleotide
Your browsing activity is empty.
Activity recording is turned off.
Turn recording back on