1991[geneid] - ClinVar - NCBI

Warning: The NCBI web site requires JavaScript to function. more...

Search results

Items: 1 to 100 of 626

<< First< Prev

Page of 7

	Variation	Gene (Protein Change)	Type (Consequence)	Condition	Classification, Review status
Select item 58787	GRCh38/hg38 19p13.3(chr19:233565-4699472)x3	LOC130063041, LOC130063042 +687 more	Copy number gain	See cases	GPathogenic
Select item 154560	GRCh38/hg38 19p13.3(chr19:259395-6795611)x3	LOC130062978, LOC130062979 +903 more	Copy number gain	See cases	GPathogenic
Select item 146110	GRCh38/hg38 19p13.3(chr19:259395-2068507)x3	LOC130062818, LOC130062819 +332 more	Copy number gain	See cases	GPathogenic
Select item 59078	GRCh38/hg38 19p13.3(chr19:259395-1952650)x3	ABCA7, ABHD17A +321 more	Copy number gain	See cases	GPathogenic
Select item 57357	GRCh38/hg38 19p13.3(chr19:259395-2555149)x3	ABCA7, ABHD17A +429 more	Copy number gain	See cases	GPathogenic
Select item 152851	GRCh38/hg38 19p13.3(chr19:275925-1892276)x3	ABCA7, ABHD17A +301 more	Copy number gain	See cases	GPathogenic
Select item 145542	GRCh38/hg38 19p13.3(chr19:421537-2897921)x3	ABCA7, ABHD17A +453 more	Copy number gain	See cases	GLikely pathogenic
Select item 59080	GRCh38/hg38 19p13.3(chr19:591812-1358152)x3	ABCA7, ARHGAP45 +168 more	Copy number gain	See cases	GPathogenic
Select item 60231	GRCh38/hg38 19p13.3(chr19:677680-899104)x3	AZU1, CFD +25 more	Copy number gain	See cases	GUncertain significance
Select item 147565	GRCh38/hg38 19p13.3(chr19:786550-1297500)x1	ABCA7, ARHGAP45 +136 more	Copy number loss	See cases	GPathogenic
Select item 145089	GRCh38/hg38 19p13.3(chr19:839492-995558)x1	ARID3A, CFD +27 more	Copy number loss	See cases	GPathogenic
Select item 3030858	NC_000019.10:g.851457A>G	ELANE	Single nucleotide variant (genic upstream transcript variant)	ELANE-related disorder	GLikely benign
Select item 3057191	NC_000019.10:g.851482T>C	ELANE	Single nucleotide variant (genic upstream transcript variant)	ELANE-related disorder	GLikely benign
Select item 667820	NM_001972.2(ELANE):c.-353G>A	ELANE	Single nucleotide variant	not provided	GBenign
Select item 1278686	NC_000019.10:g.852033T>C	ELANE	Single nucleotide variant (genic upstream transcript variant)	not provided	GBenign
Select item 1274055	NC_000019.10:g.852044C>T	ELANE	Single nucleotide variant (genic upstream transcript variant)	not provided	GBenign
Select item 677093	NM_001972.2(ELANE):c.-225C>A	ELANE	Single nucleotide variant	not provided	GBenign
Select item 678420	NM_001972.2(ELANE):c.-162C>T	ELANE	Single nucleotide variant	not provided	GLikely benign
Select item 1250740	NC_000019.10:g.852196C>T	ELANE	Single nucleotide variant (genic upstream transcript variant)	not provided	GBenign
Select item 1255032	NC_000019.10:g.852205C>T	ELANE	Single nucleotide variant (genic upstream transcript variant)	not provided	GBenign
Select item 1241499	NC_000019.10:g.852234C>T	ELANE	Single nucleotide variant (genic upstream transcript variant)	not provided	GBenign
Select item 1243625	NC_000019.10:g.852238C>G	ELANE	Single nucleotide variant (genic upstream transcript variant)	not provided	GBenign
Select item 1297304	NC_000019.10:g.852285G>C	ELANE	Single nucleotide variant (genic upstream transcript variant)	not provided	GBenign
Select item 1268417	NC_000019.10:g.852287G>A	ELANE	Single nucleotide variant (genic upstream transcript variant)	not provided	GBenign
Select item 1236936	NC_000019.10:g.852288C>T	ELANE	Single nucleotide variant (genic upstream transcript variant)	not provided	GBenign
Select item 137203	NM_001972.3(ELANE):c.-41C>A	ELANE	Single nucleotide variant	Neutropenia, severe congenital, 1, autosomal dominant +3 more	GBenign
Select item 1297299	NM_001972.4(ELANE):c.-11C>T	ELANE	Single nucleotide variant (5 prime UTR variant)	not provided	GBenign
Select item 3032788	NM_001972.4(ELANE):c.-5C>T	ELANE	Single nucleotide variant (5 prime UTR variant)	ELANE-related disorder	GLikely benign
Select item 1343367	NM_001972.4(ELANE):c.1A>G (p.Met1Val)	ELANE (M1V)	Single nucleotide variant (missense variant +1 more)	Cyclical neutropenia +2 more	GPathogenic
Select item 988327	NM_001972.4(ELANE):c.2T>C (p.Met1Thr)	ELANE (M1T)	Single nucleotide variant (missense variant +1 more)	not provided	GPathogenic
Select item 705531	NM_001972.4(ELANE):c.9C>T (p.Leu3=)	ELANE	Single nucleotide variant (synonymous variant)	Cyclical neutropenia +1 more	GLikely benign
Select item 2635364	NM_001972.4(ELANE):c.10G>C (p.Gly4Arg)	ELANE (G4R)	Single nucleotide variant (missense variant)	ELANE-related disorder	GUncertain significance
Select item 570477	NM_001972.4(ELANE):c.10G>A (p.Gly4Ser)	ELANE (G4S)	Single nucleotide variant (missense variant)	Cyclical neutropenia +1 more	GUncertain significance
Select item 567638	NM_001972.4(ELANE):c.12CCG[3] (p.Arg6dup)	ELANE	Microsatellite (inframe_insertion)	Cyclical neutropenia +1 more	GUncertain significance
Select item 3353408	NM_001972.4(ELANE):c.13C>G (p.Arg5Gly)	ELANE (R5G)	Single nucleotide variant (missense variant)	ELANE-related disorder	GUncertain significance
Select item 1694265	NM_001972.4(ELANE):c.13C>T (p.Arg5Cys)	ELANE (R5C)	Single nucleotide variant (missense variant)	Autoinflammatory syndrome	GUncertain significance
Select item 2413449	NM_001972.4(ELANE):c.14G>T (p.Arg5Leu)	ELANE (R5L)	Single nucleotide variant (missense variant)	Cyclical neutropenia +1 more	GUncertain significance
Select item 661641	NM_001972.4(ELANE):c.14G>A (p.Arg5His)	ELANE (R5H)	Single nucleotide variant (missense variant)	Cyclical neutropenia +1 more	GUncertain significance
Select item 467829	NM_001972.4(ELANE):c.16C>A (p.Arg6=)	ELANE	Single nucleotide variant (synonymous variant)	Cyclical neutropenia +4 more	GBenign/Likely benign
Select item 1061923	NM_001972.4(ELANE):c.19C>T (p.Leu7Phe)	ELANE (L7F)	Single nucleotide variant (missense variant)	Cyclical neutropenia +2 more	GConflicting classifications of pathogenicity
Select item 435054	NM_001972.4(ELANE):c.21C>T (p.Leu7=)	ELANE	Single nucleotide variant (synonymous variant)	Inborn genetic diseases +4 more	GBenign/Likely benign
Select item 2940528	NM_001972.4(ELANE):c.22G>C (p.Ala8Pro)	ELANE (A8P)	Single nucleotide variant (missense variant)	Cyclical neutropenia +1 more	GUncertain significance
Select item 242275	NM_001972.4(ELANE):c.22G>A (p.Ala8Thr)	ELANE (A8T)	Single nucleotide variant (missense variant)	not provided +3 more	GConflicting classifications of pathogenicity
Select item 968956	NM_001972.4(ELANE):c.23C>G (p.Ala8Gly)	ELANE (A8G)	Single nucleotide variant (missense variant)	Inborn genetic diseases +2 more	GUncertain significance
Select item 242276	NM_001972.4(ELANE):c.23C>T (p.Ala8Val)	ELANE (A8V)	Single nucleotide variant (missense variant)	Neutropenia, severe congenital, 1, autosomal dominant +3 more	GConflicting classifications of pathogenicity
Select item 1615721	NM_001972.4(ELANE):c.24G>A (p.Ala8=)	ELANE	Single nucleotide variant (synonymous variant)	Neutropenia, severe congenital, 1, autosomal dominant +2 more	GLikely benign
Select item 535845	NM_001972.4(ELANE):c.24G>C (p.Ala8=)	ELANE	Single nucleotide variant (synonymous variant)	Neutropenia, severe congenital, 1, autosomal dominant +1 more	GLikely benign
Select item 1036268	NM_001972.4(ELANE):c.25T>C (p.Cys9Arg)	ELANE (C9R)	Single nucleotide variant (missense variant)	Cyclical neutropenia +1 more	GUncertain significance
Select item 2031741	NM_001972.4(ELANE):c.36C>G (p.Leu12=)	ELANE	Single nucleotide variant (synonymous variant)	Neutropenia, severe congenital, 1, autosomal dominant +1 more	GLikely benign
Select item 508375	NM_001972.4(ELANE):c.36C>A (p.Leu12=)	ELANE	Single nucleotide variant (synonymous variant)	Cyclical neutropenia +2 more	GLikely benign
Select item 535841	NM_001972.4(ELANE):c.38C>G (p.Ala13Gly)	ELANE (A13G)	Single nucleotide variant (missense variant)	Neutropenia, severe congenital, 1, autosomal dominant +1 more	GUncertain significance
Select item 651605	NM_001972.4(ELANE):c.39C>G (p.Ala13=)	ELANE	Single nucleotide variant (synonymous variant)	Cyclical neutropenia +1 more	GUncertain significance
Select item 1369886	NM_001972.4(ELANE):c.41G>A (p.Cys14Tyr)	ELANE (C14Y)	Single nucleotide variant (missense variant)	Cyclical neutropenia +1 more	GUncertain significance
Select item 1148570	NM_001972.4(ELANE):c.45C>G (p.Val15=)	ELANE	Single nucleotide variant (synonymous variant)	Neutropenia, severe congenital, 1, autosomal dominant +1 more	GLikely benign
Select item 1160289	NM_001972.4(ELANE):c.51G>T (p.Pro17=)	ELANE	Single nucleotide variant (synonymous variant)	Cyclical neutropenia +1 more	GLikely benign
Select item 208492	NM_001972.4(ELANE):c.52G>C (p.Ala18Pro)	ELANE (A18P)	Single nucleotide variant (missense variant)	Neutropenia, severe congenital, 1, autosomal dominant +1 more	GUncertain significance
Select item 245741	NM_001972.4(ELANE):c.60G>A (p.Leu20=)	ELANE	Single nucleotide variant (synonymous variant)	not specified	GBenign
Select item 3059550	NM_001972.4(ELANE):c.61C>T (p.Leu21=)	ELANE	Single nucleotide variant (synonymous variant)	ELANE-related disorder	GLikely benign
Select item 1251698	NM_001972.4(ELANE):c.63G>T (p.Leu21=)	ELANE	Single nucleotide variant (synonymous variant)	not provided +3 more	GBenign/Likely benign
Select item 265117	NM_001972.4(ELANE):c.67+1del	ELANE	Deletion (splice donor variant)	not provided	GUncertain significance
Select item 665494	NM_001972.4(ELANE):c.64G>C (p.Gly22Arg)	ELANE (G22R)	Single nucleotide variant (missense variant)	Cyclical neutropenia +1 more	GUncertain significance
Select item 1043648	NM_001972.4(ELANE):c.66G>A (p.Gly22=)	ELANE	Single nucleotide variant (synonymous variant)	Cyclical neutropenia +1 more	GLikely benign
Select item 639706	NM_001972.4(ELANE):c.67+1G>T	ELANE	Single nucleotide variant (splice donor variant)	Cyclical neutropenia +1 more	GUncertain significance
Select item 2954228	NM_001972.4(ELANE):c.67+7T>A	ELANE	Single nucleotide variant (intron variant)	Cyclical neutropenia +1 more	GLikely benign
Select item 2156434	NM_001972.4(ELANE):c.67+7T>C	ELANE	Single nucleotide variant (intron variant)	Cyclical neutropenia +1 more	GLikely benign
Select item 1624479	NM_001972.4(ELANE):c.67+20C>T	ELANE	Single nucleotide variant (intron variant)	Cyclical neutropenia +1 more	GLikely benign
Select item 1298045	NM_001972.4(ELANE):c.67+199A>G	ELANE	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 1297175	NM_001972.4(ELANE):c.67+210dup	ELANE	Duplication (intron variant)	not provided	GBenign
Select item 1298049	NM_001972.4(ELANE):c.67+209_67+210del	ELANE	Deletion (intron variant)	not provided	GBenign
Select item 1298047	NM_001972.4(ELANE):c.67+210del	ELANE	Deletion (intron variant)	not provided	GBenign
Select item 1213062	NM_001972.4(ELANE):c.68-145GATCCCGTGGGTTCCCGGTGGGG[3]	ELANE	Microsatellite (intron variant)	not provided	GLikely benign
Select item 670422	NM_001972.4(ELANE):c.68-107_68-85del	ELANE	Microsatellite (intron variant)	not provided	GBenign
Select item 1251657	NM_001972.4(ELANE):c.68-129G>A	ELANE	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 1237692	NM_001972.4(ELANE):c.68-106G>A	ELANE	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 1248872	NM_001972.4(ELANE):c.68-84T>C	ELANE	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 1244597	NM_001972.4(ELANE):c.68-79G>A	ELANE	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 1250601	NM_001972.4(ELANE):c.68-64C>T	ELANE	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 1297318	NM_001972.4(ELANE):c.68-61T>A	ELANE	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 2041864	NM_001972.4(ELANE):c.68-20C>T	ELANE	Single nucleotide variant (intron variant)	Neutropenia, severe congenital, 1, autosomal dominant +1 more	GLikely benign
Select item 1297310	NM_001972.4(ELANE):c.68-19G>A	ELANE	Single nucleotide variant (intron variant)	not provided +2 more	GBenign/Likely benign
Select item 1268942	NM_001972.4(ELANE):c.68-15C>A	ELANE	Single nucleotide variant (intron variant)	Cyclical neutropenia +2 more	GBenign
Select item 2069512	NM_001972.4(ELANE):c.68-14C>T	ELANE	Single nucleotide variant (intron variant)	Cyclical neutropenia +1 more	GLikely benign
Select item 511638	NM_001972.4(ELANE):c.68-13G>A	ELANE	Single nucleotide variant (intron variant)	not specified +3 more	GConflicting classifications of pathogenicity
Select item 435052	NM_001972.4(ELANE):c.68-12G>T	ELANE	Single nucleotide variant (intron variant)	not specified	GUncertain significance
Select item 2068618	NM_001972.4(ELANE):c.68-5C>A	ELANE	Single nucleotide variant (intron variant)	Cyclical neutropenia +1 more	GLikely benign
Select item 1694271	NM_001972.4(ELANE):c.68G>A (p.Gly23Asp)	ELANE (G23D)	Single nucleotide variant (missense variant)	Autoinflammatory syndrome +2 more	GUncertain significance
Select item 657200	NM_001972.4(ELANE):c.70A>C (p.Thr24Pro)	ELANE (T24P)	Single nucleotide variant (missense variant)	Cyclical neutropenia +1 more	GUncertain significance
Select item 1718175	NM_001972.4(ELANE):c.73G>A (p.Ala25Thr)	ELANE (A25T)	Single nucleotide variant (missense variant)	Cyclical neutropenia +1 more	GUncertain significance
Select item 3341948	NM_001972.4(ELANE):c.74C>T (p.Ala25Val)	ELANE (A25V)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1397594	NM_001972.4(ELANE):c.74C>A (p.Ala25Glu)	ELANE (A25E)	Single nucleotide variant (missense variant)	Cyclical neutropenia +1 more	GUncertain significance
Select item 242277	NM_001972.4(ELANE):c.77T>C (p.Leu26Pro)	ELANE (L26P)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 3088123	NM_001972.4(ELANE):c.80C>A (p.Ala27Asp)	ELANE (A27D)	Single nucleotide variant (missense variant)	Inborn genetic diseases	GUncertain significance
Select item 1573645	NM_001972.4(ELANE):c.81C>T (p.Ala27=)	ELANE	Single nucleotide variant (synonymous variant)	Neutropenia, severe congenital, 1, autosomal dominant +1 more	GLikely benign
Select item 3088124	NM_001972.4(ELANE):c.83C>T (p.Ser28Leu)	ELANE (S28L)	Single nucleotide variant (missense variant)	Inborn genetic diseases	GUncertain significance
Select item 2929886	NM_001972.4(ELANE):c.85G>A (p.Glu29Lys)	ELANE (E29K)	Single nucleotide variant (missense variant)	Cyclical neutropenia +1 more	GUncertain significance
Select item 988479	NM_001972.4(ELANE):c.90T>G (p.Ile30Met)	ELANE (I30M)	Single nucleotide variant (missense variant)	not provided	GLikely pathogenic
Select item 1694275	NM_001972.4(ELANE):c.91del (p.Val31fs)	ELANE (V31fs)	Deletion (frameshift variant)	Autoinflammatory syndrome	GLikely pathogenic
Select item 1423973	NM_001972.4(ELANE):c.91G>A (p.Val31Met)	ELANE (V31M)	Single nucleotide variant (missense variant)	Cyclical neutropenia +1 more	GUncertain significance
Select item 3507749	NM_001972.4(ELANE):c.93G>A (p.Val31=)	ELANE	Single nucleotide variant (synonymous variant)	Inborn genetic diseases	GLikely benign
Select item 2060033	NM_001972.4(ELANE):c.98del (p.Gly33fs)	ELANE (G33fs)	Deletion (frameshift variant)	Cyclical neutropenia +2 more	GConflicting classifications of pathogenicity

<< First< Prev

Page of 7