57215[geneid] - ClinVar - NCBI

Warning: The NCBI web site requires JavaScript to function. more...

Search results

Items: 1 to 100 of 158

<< First< Prev

Page of 2

	Variation	Gene (Protein Change)	Type (Consequence)	Condition	Classification, Review status
Select item 155685	GRCh38/hg38 16q12.1-22.1(chr16:49685521-68401712)x3	LOC130059125, LOC130059126 +675 more	Copy number gain	See cases	GPathogenic
Select item 155358	GRCh38/hg38 16q12.2-24.3(chr16:52899183-90088654)x3	MIR138-2, MIR140 +1738 more	Copy number gain	See cases	GPathogenic
Select item 58630	GRCh38/hg38 16q13-22.2(chr16:56883592-71279975)x3	LOC130059330, LOC130059331 +599 more	Copy number gain	See cases	GPathogenic
Select item 58632	GRCh38/hg38 16q21-23.1(chr16:58456122-74708723)x3	LOC130059197, LOC130059198 +575 more	Copy number gain	See cases	GPathogenic
Select item 146601	GRCh38/hg38 16q21-24.1(chr16:62925929-84585795)x3	AARS1, ACD +939 more	Copy number gain	See cases	GPathogenic
Select item 59493	GRCh38/hg38 16q21-22.1(chr16:64311275-68062011)x1	ACD, AGRP +217 more	Copy number loss	See cases	GPathogenic
Select item 154511	GRCh38/hg38 16q21-24.3(chr16:64389378-90081985)x3	LOC130059829, LOC130059830 +1429 more	Copy number gain	See cases	GPathogenic
Select item 58645	GRCh38/hg38 16q21-24.3(chr16:65313395-90081985)x3	LOC108281164, LOC109029536 +1426 more	Copy number gain	See cases	GPathogenic
Select item 150599	GRCh38/hg38 16q21-24.3(chr16:65511483-90096995)x3	LOC130059834, LOC130059835 +1424 more	Copy number gain	See cases	GPathogenic
Select item 155675	GRCh38/hg38 16q21-23.3(chr16:65957829-83611443)x3	LOC130059420, LOC130059421 +869 more	Copy number gain	See cases	GPathogenic
Select item 59494	GRCh38/hg38 16q22.1(chr16:66694180-67865445)x1	ACD, AGRP +155 more	Copy number loss	See cases	GPathogenic
Select item 1261698	NC_000016.10:g.67842118G>A	CENPT, THAP11	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 1234484	NM_020457.3(THAP11):c.-105G>A	LOC130059242, THAP11 +1 more	Single nucleotide variant (5 prime UTR variant +1 more)	not provided	GBenign
Select item 1627825	NM_020457.3(THAP11):c.9C>G (p.Gly3=)	CENPT, THAP11	Single nucleotide variant (synonymous variant +1 more)	not provided	GBenign
Select item 1544891	NM_020457.3(THAP11):c.18C>T (p.Cys6=)	CENPT, THAP11	Single nucleotide variant (synonymous variant +1 more)	not specified +1 more	GBenign
Select item 1957942	NM_020457.3(THAP11):c.38A>G (p.Asn13Ser)	CENPT, THAP11 (N13S)	Single nucleotide variant (missense variant +1 more)	not provided +1 more	GUncertain significance
Select item 2893792	NM_020457.3(THAP11):c.81A>C (p.Pro27=)	CENPT, THAP11	Single nucleotide variant (synonymous variant +1 more)	not provided	GUncertain significance
Select item 2075484	NM_020457.3(THAP11):c.120G>A (p.Val40=)	CENPT, THAP11	Single nucleotide variant (synonymous variant +1 more)	not provided	GLikely benign
Select item 1617360	NM_020457.3(THAP11):c.135C>T (p.Val45=)	THAP11, CENPT	Single nucleotide variant (synonymous variant +1 more)	not provided	GLikely benign
Select item 1454662	NM_020457.3(THAP11):c.219G>A (p.Thr73=)	CENPT, THAP11	Single nucleotide variant (synonymous variant +1 more)	not provided	GLikely benign
Select item 2898349	NM_020457.3(THAP11):c.225C>G (p.Arg75=)	CENPT, THAP11	Single nucleotide variant (synonymous variant +1 more)	not provided	GLikely benign
Select item 1645869	NM_020457.3(THAP11):c.237C>T (p.Ile79=)	CENPT, THAP11	Single nucleotide variant (synonymous variant +1 more)	not provided	GLikely benign
Select item 2046828	NM_020457.3(THAP11):c.240C>T (p.Phe80=)	CENPT, THAP11	Single nucleotide variant (synonymous variant +1 more)	not provided	GBenign
Select item 393304	NM_020457.3(THAP11):c.240C>G (p.Phe80Leu)	THAP11, CENPT (F80L)	Single nucleotide variant (missense variant +1 more)	Methylmalonic acidemia with homocystinuria, type cblX	GLikely pathogenic
Select item 1441894	NM_020457.3(THAP11):c.257A>G (p.Asn86Ser)	CENPT, THAP11 (N86S)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 2082417	NM_020457.3(THAP11):c.298G>T (p.Ala100Ser)	CENPT, THAP11 (A100S)	Single nucleotide variant (missense variant +1 more)	not specified +1 more	GUncertain significance
Select item 2110433	NM_020457.3(THAP11):c.321_335dup (p.Gln132_Ser133insGlnGlnGlnGlnGln)	CENPT, THAP11	Duplication (inframe_insertion +1 more)	not provided	GLikely benign
Select item 1635911	NM_020457.3(THAP11):c.312GCAGCAGCAACAGCAGCA[3] (p.Gln132_Ser133insGlnGlnGlnGlnGlnGln)	CENPT, THAP11	Microsatellite (inframe_insertion +1 more)	not provided	GLikely benign
Select item 2866512	NM_020457.3(THAP11):c.312GCAGCAGCAACAGCAGCA[1] (p.Gln127_Gln132del)	CENPT, THAP11	Microsatellite (inframe_deletion +1 more)	not provided	GLikely benign
Select item 2709573	NM_020457.3(THAP11):c.309GCA[1] (p.Gln130_Gln132del)	CENPT, THAP11	Microsatellite (inframe_deletion +1 more)	not provided	GLikely benign
Select item 2761174	NM_020457.3(THAP11):c.321_332del (p.Gln129_Gln132del)	CENPT, THAP11	Deletion (inframe_deletion +1 more)	not provided	GLikely benign
Select item 3176877	NM_020457.3(THAP11):c.311A>G (p.Gln104Arg)	CENPT, THAP11 (Q104R)	Single nucleotide variant (missense variant +1 more)	not specified	GUncertain significance
Select item 2171698	NM_020457.3(THAP11):c.321ACAGCAGCAGCAGCAGCAACAGCAGCA[3] (p.Gln132_Ser133insGlnGlnGlnGlnGlnGlnGlnGlnGln)	CENPT, THAP11	Microsatellite (inframe_insertion +1 more)	not provided	GUncertain significance
Select item 2065673	NM_020457.3(THAP11):c.321_329dup (p.Gln132_Ser133insGlnGlnGln)	CENPT, THAP11	Duplication (inframe_insertion +1 more)	not provided	GLikely benign
Select item 2200643	NM_020457.3(THAP11):c.321_329del (p.Gln130_Gln132del)	CENPT, THAP11	Deletion (inframe_deletion +1 more)	not provided	GLikely benign
Select item 1421063	NM_020457.3(THAP11):c.321ACAGCAGCAGCAGCAGCAACAGCAGCA[1] (p.Gln124_Gln132del)	CENPT, THAP11	Microsatellite (inframe_deletion +1 more)	not provided	GUncertain significance
Select item 2160628	NM_020457.3(THAP11):c.321_326dup (p.Gln132_Ser133insGlnGln)	CENPT, THAP11	Duplication (inframe_insertion +1 more)	not provided	GLikely benign
Select item 2720443	NM_020457.3(THAP11):c.321_323del (p.Gln132del)	CENPT, THAP11 (Q132del)	Deletion (inframe_deletion +1 more)	not provided	GLikely benign
Select item 2758935	NM_020457.3(THAP11):c.324GCA[6] (p.Gln132_Ser133insGln)	CENPT, THAP11	Microsatellite (inframe_insertion +1 more)	not provided	GUncertain significance
Select item 2172347	NM_020457.3(THAP11):c.347_348insGCAGCAGCAGCAGCAGCAACAGCAGCA (p.Gln132_Ser133insGlnGlnGlnGlnGlnGlnGlnGlnGln)	CENPT, THAP11	Microsatellite (inframe_insertion +1 more)	not provided	GLikely benign
Select item 2114822	NM_020457.3(THAP11):c.347_348insGCAGCAGCAGCAGCAGCAACAGCAGCAGCAGCAGCAGCAGCAGCAACAGCAGCA (p.Gln132_Ser133insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)	CENPT, THAP11	Insertion (inframe_insertion +1 more)	not provided	GUncertain significance
Select item 1625453	NM_020457.3(THAP11):c.321A>G (p.Gln107=)	THAP11, CENPT	Single nucleotide variant (synonymous variant +1 more)	not provided	GBenign
Select item 1952408	NM_020457.3(THAP11):c.324GCA[1] (p.Gln129_Gln132del)	CENPT, THAP11	Microsatellite (inframe_deletion +1 more)	not provided	GLikely benign
Select item 1597606	NM_020457.3(THAP11):c.339_362del (p.Gln125_Gln132del)	CENPT, THAP11	Deletion (inframe_deletion +1 more)	not provided	GLikely benign
Select item 1897215	NM_020457.3(THAP11):c.339_359dup (p.Gln132_Ser133insGlnGlnGlnGlnGlnGlnGln)	CENPT, THAP11	Duplication (inframe_insertion +1 more)	not provided	GLikely benign
Select item 2193874	NM_020457.3(THAP11):c.339ACAGCAGCA[3] (p.Gln132_Ser133insGlnGlnGln)	CENPT, THAP11	Microsatellite (inframe_insertion +1 more)	not provided	GUncertain significance
Select item 2178293	NM_020457.3(THAP11):c.333_334insAAGCAACAG (p.Gln111_Gln112insLysGlnGln)	CENPT, THAP11	Insertion (inframe_insertion +1 more)	not provided	GUncertain significance
Select item 1552629	NM_020457.3(THAP11):c.339ACAGCAGCA[1] (p.Gln130_Gln132del)	THAP11, CENPT	Microsatellite (inframe_deletion +1 more)	not provided	GLikely benign
Select item 2720014	NM_020457.3(THAP11):c.347_348insGCAGCAGCAACAGCAGCAGCA (p.Gln132_Ser133insGlnGlnGlnGlnGlnGlnGln)	CENPT, THAP11	Microsatellite (inframe_insertion +1 more)	not provided	GLikely benign
Select item 2715781	NM_020457.3(THAP11):c.339A>G (p.Gln113=)	CENPT, THAP11	Single nucleotide variant (synonymous variant +1 more)	not provided	GLikely benign
Select item 2061004	NM_020457.3(THAP11):c.348ACAGCAGCAGCAGCAGCA[3] (p.Gln132_Ser133insGlnGlnGlnGlnGlnGln)	CENPT, THAP11	Microsatellite (inframe_insertion +1 more)	not provided	GLikely benign
Select item 2053264	NM_020457.3(THAP11):c.348_377del (p.Gln123_Gln132del)	CENPT, THAP11	Deletion (inframe_deletion +1 more)	not provided	GUncertain significance
Select item 2049481	NM_020457.3(THAP11):c.348ACAGCAGCAGCAGCAGCA[1] (p.Gln127_Gln132del)	CENPT, THAP11	Microsatellite (inframe_deletion +1 more)	not provided	GLikely benign
Select item 2865080	NM_020457.3(THAP11):c.348_353del (p.Gln131_Gln132del)	CENPT, THAP11	Deletion (inframe_deletion +1 more)	not provided	GLikely benign
Select item 2047073	NM_020457.3(THAP11):c.348_350del (p.Gln132del)	CENPT, THAP11 (Q132del)	Deletion (inframe_deletion +1 more)	not provided	GLikely benign
Select item 3015514	NM_020457.3(THAP11):c.351GCA[8] (p.Gln132_Ser133insGlnGlnGln)	CENPT, THAP11	Microsatellite (inframe_insertion +1 more)	not provided	GUncertain significance
Select item 2712262	NM_020457.3(THAP11):c.351GCA[6] (p.Gln132_Ser133insGln)	CENPT, THAP11	Microsatellite (inframe_insertion +1 more)	not provided	GUncertain significance
Select item 2068867	NM_020457.3(THAP11):c.351GCA[7] (p.Gln132_Ser133insGlnGln)	CENPT, THAP11	Microsatellite (inframe_insertion +1 more)	not provided	GLikely benign
Select item 1910278	NM_020457.3(THAP11):c.348A>C (p.Gln116His)	CENPT, THAP11 (Q116H)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 1651592	NM_020457.3(THAP11):c.348A>G (p.Gln116=)	CENPT, THAP11	Single nucleotide variant (synonymous variant +1 more)	not provided	GBenign
Select item 1598988	NM_020457.3(THAP11):c.366_392dup (p.Gln132_Ser133insGlnGlnGlnGlnGlnGlnGlnGlnGln)	THAP11, CENPT	Duplication (inframe_insertion +1 more)	not provided	GBenign
Select item 2905659	NM_020457.3(THAP11):c.364_396del (p.Gln122_Gln132del)	CENPT, THAP11	Deletion (inframe_deletion +1 more)	not provided	GUncertain significance
Select item 2157122	NM_020457.3(THAP11):c.366_395del (p.Gln123_Gln132del)	CENPT, THAP11	Deletion (inframe_deletion +1 more)	not provided	GUncertain significance
Select item 2081490	NM_020457.3(THAP11):c.351GCA[3] (p.Gln131_Gln132del)	CENPT, THAP11	Microsatellite (inframe_deletion +1 more)	not provided	GLikely benign
Select item 1582497	NM_020457.3(THAP11):c.366_389del (p.Gln125_Gln132del)	CENPT, THAP11	Deletion (inframe_deletion +1 more)	not provided	GBenign
Select item 1552811	NM_020457.3(THAP11):c.366_386del (p.Gln126_Gln132del)	CENPT, THAP11	Deletion (inframe_deletion +1 more)	not provided	GBenign
Select item 1349465	NM_020457.3(THAP11):c.366_392del (p.Gln124_Gln132del)	CENPT, THAP11	Deletion (inframe_deletion +1 more)	not provided	GUncertain significance
Select item 2155139	NM_020457.3(THAP11):c.356_357insACAGCA (p.Gln132_Ser133insGlnGln)	CENPT, THAP11	Insertion (inframe_insertion +1 more)	not provided	GUncertain significance
Select item 2161576	NM_020457.3(THAP11):c.366_380del (p.Gln128_Gln132del)	CENPT, THAP11	Deletion (inframe_deletion +1 more)	not provided	GLikely benign
Select item 2070905	NM_020457.3(THAP11):c.359_360insACA (p.Gln132_Ser133insGln)	CENPT, THAP11	Insertion (inframe_insertion +1 more)	not provided	GLikely benign
Select item 2062699	NM_020457.3(THAP11):c.357G>A (p.Gln119=)	CENPT, THAP11	Single nucleotide variant (synonymous variant +1 more)	not provided	GLikely benign
Select item 2182219	NM_020457.3(THAP11):c.366_374del (p.Gln130_Gln132del)	CENPT, THAP11	Deletion (inframe_deletion +1 more)	not provided	GLikely benign
Select item 2047074	NM_020457.3(THAP11):c.360G>A (p.Gln120=)	CENPT, THAP11	Single nucleotide variant (synonymous variant +1 more)	not provided	GLikely benign
Select item 1567188	NM_020457.3(THAP11):c.366_371dup (p.Gln132_Ser133insGlnGln)	CENPT, THAP11	Duplication (inframe_insertion +1 more)	not provided	GLikely benign
Select item 2866657	NM_020457.3(THAP11):c.366_368del (p.Gln132del)	CENPT, THAP11 (Q132del)	Deletion (inframe_deletion +1 more)	not provided	GLikely benign
Select item 2741681	NM_020457.3(THAP11):c.367CAG[15] (p.Gln132_Ser133insGlnGlnGlnGlnGln)	CENPT, THAP11	Microsatellite (inframe_insertion +1 more)	not provided	GLikely benign
Select item 2082660	NM_020457.3(THAP11):c.367CAG[19] (p.Gln132_Ser133insGlnGlnGlnGlnGlnGlnGlnGlnGln)	CENPT, THAP11	Microsatellite (inframe_insertion +1 more)	not provided	GLikely benign
Select item 1979282	NM_020457.3(THAP11):c.367CAG[18] (p.Gln132_Ser133insGlnGlnGlnGlnGlnGlnGlnGln)	CENPT, THAP11	Microsatellite (inframe_insertion +1 more)	not provided	GUncertain significance
Select item 1653316	NM_020457.3(THAP11):c.366A>G (p.Gln122=)	CENPT, THAP11	Single nucleotide variant (synonymous variant +1 more)	not provided	GLikely benign
Select item 1645486	NM_020457.3(THAP11):c.367CAG[12] (p.Gln132_Ser133insGlnGln)	CENPT, THAP11	Microsatellite (inframe_insertion +1 more)	not provided	GLikely benign
Select item 1624627	NM_020457.3(THAP11):c.367CAG[11] (p.Gln132_Ser133insGln)	CENPT, THAP11	Microsatellite (inframe_insertion +1 more)	not provided	GLikely benign
Select item 1579560	NM_020457.3(THAP11):c.367CAG[13] (p.Gln132_Ser133insGlnGlnGln)	CENPT, THAP11	Microsatellite (inframe_insertion +1 more)	not provided	GLikely benign
Select item 2713203	NM_020457.3(THAP11):c.367CAG[5] (p.Gln128_Gln132del)	CENPT, THAP11	Microsatellite (inframe_deletion +1 more)	not provided	GLikely benign
Select item 1611213	NM_020457.3(THAP11):c.367CAG[4] (p.Gln127_Gln132del)	THAP11, CENPT	Microsatellite (inframe_deletion +1 more)	not provided	GLikely benign
Select item 1587439	NM_020457.3(THAP11):c.367CAG[7] (p.Gln130_Gln132del)	CENPT, THAP11	Microsatellite (inframe_deletion +1 more)	not provided	GLikely benign
Select item 1581609	NM_020457.3(THAP11):c.367CAG[6] (p.Gln129_Gln132del)	CENPT, THAP11	Microsatellite (inframe_deletion +1 more)	not provided	GLikely benign
Select item 1528605	NM_020457.3(THAP11):c.367CAG[8] (p.Gln131_Gln132del)	CENPT, THAP11	Microsatellite (inframe_deletion +1 more)	not provided	GLikely benign
Select item 769902	NM_020457.3(THAP11):c.367CAG[9] (p.Gln132del)	CENPT, THAP11 (Q132del)	Microsatellite (inframe_deletion +1 more)	not provided	GBenign
Select item 2914513	NM_020457.3(THAP11):c.386_387insACAGCAGCAGCAGCAGCA (p.Gln132_Ser133insGlnGlnGlnGlnGlnGln)	CENPT, THAP11	Microsatellite (inframe_insertion +1 more)	not provided	GUncertain significance
Select item 2734485	NM_020457.3(THAP11):c.374_375insACAGCA (p.Gln132_Ser133insGlnGln)	CENPT, THAP11	Insertion (inframe_insertion +1 more)	not provided	GLikely benign
Select item 2170345	NM_020457.3(THAP11):c.374_375insACAGCAGCAGCAGCAGCAACAGCA (p.Gln132_Ser133insGlnGlnGlnGlnGlnGlnGlnGln)	CENPT, THAP11	Insertion (inframe_insertion +1 more)	not provided	GLikely benign
Select item 2062700	NM_020457.3(THAP11):c.383_384insACAGCAGCAGCAGCA (p.Gln132_Ser133insGlnGlnGlnGlnGln)	CENPT, THAP11	Microsatellite (inframe_insertion +1 more)	not provided	GLikely benign
Select item 1627226	NM_020457.3(THAP11):c.392_393insACAGCAGCAGCAGCAGCAGCAGCA (p.Gln132_Ser133insGlnGlnGlnGlnGlnGlnGlnGln)	CENPT, THAP11	Microsatellite (inframe_insertion +1 more)	not provided	GLikely benign
Select item 1606856	NM_020457.3(THAP11):c.369G>A (p.Gln123=)	CENPT, THAP11	Single nucleotide variant (synonymous variant +1 more)	not provided	GLikely benign
Select item 1593600	NM_020457.3(THAP11):c.392_393insACAGCAGCAGCAGCAGCAGCA (p.Gln132_Ser133insGlnGlnGlnGlnGlnGlnGln)	CENPT, THAP11	Microsatellite (inframe_insertion +1 more)	not provided	GLikely benign
Select item 2958600	NM_020457.3(THAP11):c.375G>A (p.Gln125=)	CENPT, THAP11	Single nucleotide variant (synonymous variant +1 more)	not provided	GLikely benign
Select item 2899059	NM_020457.3(THAP11):c.392_393insACAGCAGCAGCAGCAGCA (p.Gln132_Ser133insGlnGlnGlnGlnGlnGln)	CENPT, THAP11	Microsatellite (inframe_insertion +1 more)	not provided	GUncertain significance
Select item 2880723	NM_020457.3(THAP11):c.383_384insACAGCAGCA (p.Gln132_Ser133insGlnGlnGln)	CENPT, THAP11	Microsatellite (inframe_insertion +1 more)	not provided	GUncertain significance
Select item 2646641	NM_020457.3(THAP11):c.381G>A (p.Gln127=)	CENPT, THAP11	Single nucleotide variant (synonymous variant +1 more)	not provided	GLikely benign
Select item 1582213	NM_020457.3(THAP11):c.392_393insACAGCAGCAGCA (p.Gln132_Ser133insGlnGlnGlnGln)	CENPT, THAP11	Microsatellite (inframe_insertion +1 more)	not provided	GLikely benign

<< First< Prev

Page of 2