HRCT1[gene] - ClinVar - NCBI

Warning: The NCBI web site requires JavaScript to function. more...

Search results

Items: 1 to 100 of 113

<< First< Prev

Page of 2

	Variation	Gene (Protein Change)	Type (Consequence)	Condition	Classification, Review status
Select item 146018	GRCh38/hg38 9p24.3-q21.11(chr9:13997-68401065)x3	LOC130001767, LOC130001768 +1006 more	Copy number gain	See cases	GPathogenic
Select item 160862	GRCh38/hg38 9p24.3-q34.3(chr9:193412-138179445)x3	LOC124210612, LOC124210613 +3786 more	Copy number gain	See cases	GPathogenic
Select item 154945	GRCh38/hg38 9p24.3-q21.31(chr9:193412-79877816)x3	CDKN2B, CDKN2B-AS1 +1214 more	Copy number gain	See cases	GPathogenic
Select item 150340	GRCh38/hg38 9p11.2-q34.3(chr9:193412-138159073)x3	LOC121331326, LOC121331327 +3785 more	Copy number gain	See cases	GPathogenic
Select item 150050	GRCh38/hg38 9p24.3-q34.3(chr9:193412-138159073)x3	LOC126860737, LOC126860738 +3786 more	Copy number gain	See cases	GPathogenic
Select item 149828	GRCh38/hg38 9p24.3-q34.3(chr9:193412-138124524)x3	ABCA1, ABCA2 +3786 more	Copy number gain	See cases	GPathogenic
Select item 146931	GRCh38/hg38 9p24.3-q21.12(chr9:193412-70630731)x3	LOC130001680, LOC130001681 +1062 more	Copy number gain	See cases	GPathogenic
Select item 146703	GRCh38/hg38 9p24.3-q21.13(chr9:193412-74615913)x3	LOC124210611, LOC124210612 +1120 more	Copy number gain	See cases	GPathogenic
Select item 59875	GRCh38/hg38 9p24.3-q34.3(chr9:193412-138114463)x3	LOC110121197, LOC110121234 +3786 more	Copy number gain	See cases	GPathogenic
Select item 33205	GRCh38/hg38 9p24.3-q34.3(chr9:193412-138179445)x3	LOC121331342, LOC121331343 +3786 more	Copy number gain	See cases	GPathogenic
Select item 155344	GRCh38/hg38 9p24.3-13.1(chr9:203861-38381642)	LOC130001484, LOC130001485 +883 more	Copy number gain	See cases	GPathogenic
Select item 153561	GRCh38/hg38 9p24.3-q22.1(chr9:203861-88130444)x4	LOC130001854, LOC130001855 +1367 more	Copy number gain	See cases	GPathogenic
Select item 153518	GRCh38/hg38 9p24.3-q34.3(chr9:203861-138125937)x3	LOC113839542, LOC113839543 +3786 more	Copy number gain	See cases	GPathogenic
Select item 155409	GRCh38/hg38 9p24.3-q34.3(chr9:203862-138125937)x3	ABCA1, ABCA2 +3786 more	Copy number gain	See cases	GPathogenic
Select item 150341	GRCh38/hg38 9p24.3-q21.11(chr9:204104-67549861)x3	LOC130001585, LOC130001586 +984 more	Copy number gain	See cases	GPathogenic
Select item 150242	GRCh38/hg38 9p24.3-13.1(chr9:204104-38768294)x3	LOC130001507, LOC130001508 +899 more	Copy number gain	See cases	GPathogenic
Select item 148823	GRCh38/hg38 9p24.3-q21.11(chr9:204104-66233120)x4	LOC130001746, LOC130001747 +980 more	Copy number gain	See cases	GPathogenic
Select item 160921	GRCh38/hg38 9p24.3-13.1(chr9:204193-38815478)x3	ACER2, ACO1 +899 more	Copy number gain	See cases	GPathogenic
Select item 144309	GRCh38/hg38 9p24.3-q34.3(chr9:204193-138179445)	LOC130002189, LOC130002190 +3786 more	Copy number gain	See cases	GPathogenic
Select item 57406	GRCh38/hg38 9p24.3-13.1(chr9:204193-38741440)x3	SPATA31F3, SPATA31G1 +898 more	Copy number gain	See cases	GPathogenic
Select item 32288	GRCh38/hg38 9p24.3-13.1(chr9:204193-38815478)x3	ANKRD18B, APTX +899 more	Copy number gain	See cases	GPathogenic
Select item 59876	GRCh38/hg38 9p24.3-13.1(chr9:220253-38815419)x3	ACER2, ACO1 +894 more	Copy number gain	See cases	GPathogenic
Select item 148673	GRCh38/hg38 9p24.1-13.2(chr9:7162304-37038771)x3	ACER2, ACO1 +586 more	Copy number gain	See cases	GPathogenic
Select item 151755	GRCh38/hg38 9p22.2-q21.11(chr9:18344605-68257015)	ACER2, ACO1 +691 more	Copy number gain	See cases	GPathogenic
Select item 154223	GRCh38/hg38 9p21.1-13.1(chr9:28975663-38787483)x3	ACO1, ALDH1B1 +436 more	Copy number gain	See cases	GLikely pathogenic
Select item 153185	GRCh38/hg38 9p21.1-q21.11(chr9:31426827-68257015)x3	ACO1, ALDH1B1 +504 more	Copy number gain	See cases	GPathogenic
Select item 144347	GRCh38/hg38 9p13.3-13.1(chr9:33225730-38529813)x3	ALDH1B1, ANKRD18B +360 more	Copy number gain	See cases	GPathogenic
Select item 145374	GRCh38/hg38 9p13.3-13.2(chr9:33572681-36782015)x1	PTENP1-AS, RECK +211 more	Copy number loss	See cases	GPathogenic
Select item 583788	NC_000009.11:g.(?_34645556)_(36277059_?)dup	CCIN, SPATA31F1 +138 more	Duplication	Anauxetic dysplasia	GUncertain significance
Select item 144556	GRCh38/hg38 9p13.3-13.1(chr9:35623500-38815474)x3	ALDH1B1, ANKRD18A +219 more	Copy number gain	See cases	GPathogenic
Select item 2514838	NM_001039792.2(HRCT1):c.28C>G (p.Leu10Val)	HRCT1 (L10V)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2600053	NM_001039792.2(HRCT1):c.50C>A (p.Ala17Asp)	HRCT1 (A17D)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3106942	NM_001039792.2(HRCT1):c.52G>C (p.Ala18Pro)	HRCT1 (A18P)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2509305	NM_001039792.2(HRCT1):c.59C>T (p.Ala20Val)	HRCT1 (A20V)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2354455	NM_001039792.2(HRCT1):c.88A>G (p.Thr30Ala)	HRCT1 (T30A)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2218076	NM_001039792.2(HRCT1):c.103G>A (p.Gly35Arg)	HRCT1 (G35R)	Single nucleotide variant (missense variant)	not specified	GLikely benign
Select item 3106933	NM_001039792.2(HRCT1):c.106C>T (p.Arg36Trp)	HRCT1 (R36W)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3106934	NM_001039792.2(HRCT1):c.107G>A (p.Arg36Gln)	HRCT1 (R36Q)	Single nucleotide variant (missense variant)	not specified	GLikely benign
Select item 3106935	NM_001039792.2(HRCT1):c.128G>C (p.Arg43Thr)	HRCT1 (R43T)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2373938	NM_001039792.2(HRCT1):c.149G>A (p.Gly50Glu)	HRCT1 (G50E)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3106936	NM_001039792.2(HRCT1):c.152A>T (p.Asn51Ile)	HRCT1 (N51I)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2460573	NM_001039792.2(HRCT1):c.155G>A (p.Arg52Gln)	HRCT1 (R52Q)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2363677	NM_001039792.2(HRCT1):c.160C>T (p.Arg54Cys)	HRCT1 (R54C)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2352403	NM_001039792.2(HRCT1):c.161G>A (p.Arg54His)	HRCT1 (R54H)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2511387	NM_001039792.2(HRCT1):c.163C>T (p.Arg55Trp)	HRCT1 (R55W)	Single nucleotide variant (missense variant)	not specified	GLikely benign
Select item 2507681	NM_001039792.2(HRCT1):c.164G>A (p.Arg55Gln)	HRCT1 (R55Q)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2331094	NM_001039792.2(HRCT1):c.173C>T (p.Pro58Leu)	HRCT1 (P58L)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2472681	NM_001039792.2(HRCT1):c.184C>G (p.Arg62Gly)	HRCT1 (R62G)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3106937	NM_001039792.2(HRCT1):c.190C>T (p.Arg64Trp)	HRCT1 (R64W)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2558604	NM_001039792.2(HRCT1):c.191G>A (p.Arg64Gln)	HRCT1 (R64Q)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2608416	NM_001039792.2(HRCT1):c.193G>T (p.Gly65Cys)	HRCT1 (G65C)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2659185	NM_001039792.2(HRCT1):c.220C>T (p.Arg74Cys)	HRCT1 (R74C)	Single nucleotide variant (missense variant)	not provided	GLikely benign
Select item 2384347	NM_001039792.2(HRCT1):c.221G>A (p.Arg74His)	HRCT1 (R74H)	Single nucleotide variant (missense variant)	not specified	GLikely benign
Select item 2473536	NM_001039792.2(HRCT1):c.242A>C (p.His81Pro)	HRCT1 (H81P)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3106938	NM_001039792.2(HRCT1):c.248C>T (p.Pro83Leu)	HRCT1 (P83L)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2348261	NM_001039792.2(HRCT1):c.251A>C (p.Asn84Thr)	HRCT1 (N84T)	Single nucleotide variant (missense variant)	not provided +1 more	GUncertain significance
Select item 3106939	NM_001039792.2(HRCT1):c.257G>A (p.Gly86Asp)	HRCT1 (G86D)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3284776	NM_001039792.2(HRCT1):c.272A>G (p.His91Arg)	HRCT1 (H91R)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2331460	NM_001039792.2(HRCT1):c.274C>A (p.His92Asn)	HRCT1 (H92N)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2589111	NM_001039792.2(HRCT1):c.290C>T (p.Pro97Leu)	HRCT1 (P97L)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3284775	NM_001039792.2(HRCT1):c.299T>C (p.Leu100Pro)	HRCT1 (L100P)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2343352	NM_001039792.2(HRCT1):c.302A>T (p.His101Leu)	HRCT1 (H101L)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3106941	NM_001039792.2(HRCT1):c.308A>C (p.His103Pro)	HRCT1 (H103P)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2659187	NM_001039792.2(HRCT1):c.328_329insCCCACCACACCCCTCACCACCTCCACCACCACCACCCCCACCACACCCCTCACCACCTCCACCACCACCACCACCACCACCACCGCCACC (p.His109_His110insProHisHisThrProHisHisLeuHisHisHisHisProHisHisThrProHisHisLeuHisHisHisHisHisHisHisHisArgHis)	HRCT1	Insertion (inframe_insertion)	not provided	GLikely benign
Select item 2659186	NM_001039792.2(HRCT1):c.318_322CCA[2]CACCCCTCACCACCTCCACCACCACCACCACCACCACCACC[1] (p.His107_Arg108insHisThrProHisHisLeuHisHisHisHisHisHisHisHis)	HRCT1	Microsatellite (inframe_insertion)	not provided	GLikely benign
Select item 2411925	NM_001039792.2(HRCT1):c.317C>G (p.Pro106Arg)	HRCT1 (P106R)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2659188	NM_001039792.2(HRCT1):c.323G>C (p.Arg108Pro)	HRCT1 (R108P)	Single nucleotide variant (missense variant)	not provided	GLikely benign
Select item 2562576	NM_001039792.2(HRCT1):c.334C>T (p.Arg112Cys)	HRCT1 (R112C)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3245304	NC_000009.11:g.(?_32453279)_(36276941_?)dup	ANKRD18B, APTX +75 more	Duplication	not provided	GUncertain significance
Select item 3245076	NC_000009.11:g.(?_33436037)_(37436779_?)del	ANKRD18B, AQP3 +66 more	Deletion	Spastic paraplegia	GPathogenic
Select item 3242301	GRCh37/hg19 9p13.3-13.1(chr9:35495055-39184042)x1	ALDH1B1, ANKRD18A +45 more	Copy number loss	not provided	GPathogenic
Select item 3063115	GRCh37/hg19 9p13.3-13.1(chr9:35440393-38787480)x1	ALDH1B1, ANKRD18A +44 more	Copy number loss	not specified	GLikely pathogenic
Select item 3063071	GRCh37/hg19 9p24.3-q34.3(chr9:203861-141020389)x3	DMAC1, DMRT1 +769 more	Copy number gain	not specified	GPathogenic
Select item 2684569	GRCh37/hg19 9p24.3-13.1(chr9:1475882-38771831)x3	CREB3, STOML2 +188 more	Copy number gain	not provided	GPathogenic
Select item 2427794	NC_000009.11:g.(?_34370797)_(36276941_?)dup	RGP1, RMRP +51 more	Duplication	Anauxetic dysplasia	GUncertain significance
Select item 2422485	NC_000009.11:g.(?_32453279)_(37785041_?)dup	OR13J1, OR2S2 +87 more	Duplication	not provided	GUncertain significance
Select item 1711101	GRCh37/hg19 9p24.3-q34.11(chr9:203861-131603223)x3	ADAMTSL1, CEP78 +596 more	Copy number gain	See cases	GPathogenic
Select item 1707628	GRCh37/hg19 9p24.3-13.1(chr9:48827-39154913)x3	ACER2, ACO1 +199 more	Copy number gain	Syndromic anorectal malformation	GLikely pathogenic
Select item 1703688	GRCh37/hg19 9p22.1-q33.1(chr9:19356861-119513311)	ATOSB, ATP6V1G1 +417 more	Copy number loss	Distal tetrasomy 15q	GUncertain significance
Select item 1703576	GRCh37/hg19 9p24.3-q13(chr9:203861-68342786)	ACER2, ACO1 +204 more	Copy number gain	Bradycardia	GPathogenic
Select item 1703570	GRCh37/hg19 9p24.3-q13(chr9:203861-67986965)	ACER2, ACO1 +204 more	Copy number gain	Tetrasomy 9p	GPathogenic
Select item 1527491	GRCh37/hg19 9p24.3-q34.3(chr9:353349-141020389)	ANKRD18A, ANKRD18B +768 more	Copy number gain	not specified	GPathogenic
Select item 1527488	GRCh37/hg19 9p24.3-q21.32(chr9:203861-84155399)	SPATA31A5, SPATA31A6 +257 more	Copy number gain	not specified	GPathogenic
Select item 1527487	GRCh37/hg19 9p24.3-q21.11(chr9:203861-69002883)	ACER2, ACO1 +205 more	Copy number gain	not specified	GPathogenic
Select item 1210154	GRCh37/hg19 9p13.3-13.2(chr9:35059633-37660586)x1	ARHGEF39, ATOSB +42 more	Copy number loss	Neurodevelopmental disorder	GPathogenic
Select item 1070621	NC_000009.11:g.(?_34459004)_(36276941_?)del	ARHGEF39, ARID3C +48 more	Deletion	Hyperphosphatasia with intellectual disability syndrome 2	GPathogenic
Select item 1041826	NC_000009.11:g.(?_35683146)_(36277049_?)dup	GLIPR2, GNE +17 more	Duplication	Arthrogryposis, distal, type 1A	GUncertain significance
Select item 980343	GRCh37/hg19 9p21.1-13.2(chr9:32192406-38311776)x3	ACO1, ANKRD18B +91 more	Copy number gain	not provided	GLikely pathogenic
Select item 815190	GRCh37/hg19 9p24.3-q21.11(chr9:203861-70984588)x3	ACER2, ACO1 +213 more	Copy number gain	not provided	GPathogenic
Select item 694460	NC_000009.11:g.12246100_101559378inv	ANKS6, ANP32B +326 more	Inversion	Abnormal chromosome morphology +1 more	GLikely pathogenic
Select item 689135	GRCh37/hg19 9p13.3-q13(chr9:34542635-68210033)x3	ALDH1B1, ANKRD18A +74 more	Copy number gain	not provided	GPathogenic
Select item 687476	GRCh37/hg19 9p24.3-13.1(chr9:203861-38472979)x3	CER1, CHMP5 +193 more	Copy number gain	not provided	GPathogenic
Select item 685192	GRCh37/hg19 9p24.3-q34.3(chr9:203861-141020388)x3	MSMP, OR13D1 +769 more	Copy number gain	not provided	GPathogenic
Select item 685107	GRCh37/hg19 9p24.3-q13(chr9:203861-67986965)x3	CNTNAP3B, CREB3 +204 more	Copy number gain	not provided	GPathogenic
Select item 625636	GRCh37/hg19 9p24.3-13.1(chr9:214309-39156958)	GBA2, MPDZ +195 more	Copy number gain	not provided	GPathogenic
Select item 617751	Single allele	APBA1, APTX +185 more	Complex	Glioma	GLikely pathogenic
Select item 584345	NC_000009.11:g.(?_34458984)_(36277059_?)dup	ARHGEF39, ARID3C +48 more	Duplication	Autosomal recessive distal spinal muscular atrophy 2 +1 more	GUncertain significance
Select item 563687	GRCh37/hg19 9p24.3-q21.12(chr9:203861-72717793)x3	ACER2, ACO1 +225 more	Copy number gain	not provided	GPathogenic
Select item 563686	GRCh37/hg19 9p24.3-q21.11(chr9:203861-70985795)x4	ACER2, ACO1 +213 more	Copy number gain	not provided	GPathogenic
Select item 563685	GRCh37/hg19 9p24.3-q13(chr9:203861-68262804)x3,4	CNTNAP3, CNTNAP3B +204 more	Copy number gain	not provided	GPathogenic

<< First< Prev

Page of 2