VCV003279821.1 - ClinVar

NM_001625.4(AK2):c.698_703delinsGACTCATAAACATAAACATAAACTCA (p.Lys233fs)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(1)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Uncertain significance

criteria provided, single submitter

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_001625.4(AK2):c.698_703delinsGACTCATAAACATAAACATAAACTCA (p.Lys233fs)

Variation ID: 3279821 Accession: VCV003279821.1

Type and length

Indel, 26 bp

Location

Cytogenetic: 1p35.1 1: 33013198-33013203 (GRCh38) [ NCBI UCSC ] 1: 33478799-33478804 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Aug 11, 2024	Aug 11, 2024	Mar 15, 2024

HGVS

Nucleotide	Protein	Molecular consequence
NM_001625.4:c.698_703delinsGACTCATAAACATAAACATAAACTCA MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_001616.1:p.Lys233fs	frameshift
NM_001199199.3:c.670+4_670+9delinsGACTCATAAACATAAACATAAACTCA		intron variant
NM_001319139.3:c.550+4_550+9delinsGACTCATAAACATAAACATAAACTCA		intron variant
NM_001319140.2:c.554_559delinsGACTCATAAACATAAACATAAACTCA	NP_001306069.1:p.Lys185fs	frameshift
NM_001319141.3:c.694+4_694+9delinsGACTCATAAACATAAACATAAACTCA		intron variant
NM_001319142.3:c.568+4_568+9delinsGACTCATAAACATAAACATAAACTCA		intron variant
NM_001319143.2:c.201_206delinsGACTCATAAACATAAACATAAACTCA		3 prime UTR
NM_013411.5:c.694+4_694+9delinsGACTCATAAACATAAACATAAACTCA		intron variant
NC_000001.11:g.33013198_33013203delinsTGAGTTTATGTTTATGTTTATGAGTC
NC_000001.10:g.33478799_33478804delinsTGAGTTTATGTTTATGTTTATGAGTC
NG_016269.1:g.28689_28694delinsGACTCATAAACATAAACATAAACTCA
LRG_133:g.28689_28694delinsGACTCATAAACATAAACATAAACTCA

... more HGVS ... less HGVS

Protein change

K185fs, K233fs

Other names

Canonical SPDI

NC_000001.11:33013197:AGTCTT:TGAGTTTATGTTTATGTTTATGAGTC

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
AK2		-	-	GRCh38 GRCh37	179	216

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
Inborn genetic diseases	Uncertain significance (1)	criteria provided, single submitter	Mar 15, 2024	RCV004621440.1

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Uncertain significance (Mar 15, 2024)	criteria provided, single submitter (Ambry Variant Classification Scheme 2023) Method: clinical testing	Inborn genetic diseases Affected status: unknown Allele origin: germline	Ambry Genetics Accession: SCV005118236.1 First in ClinVar: Aug 11, 2024 Last updated: Aug 11, 2024	Comment: The c.698_703delinsGACTCATAAACATAAACATAAACTCA (p.K233Rfs59) alteration, located in exon 6 (coding exon 6) of the AK2 gene, consists of a deletion of 6 and insertion of 26 … (more) The c.698_703delinsGACTCATAAACATAAACATAAACTCA (p.K233Rfs59) alteration, located in exon 6 (coding exon 6) of the AK2 gene, consists of a deletion of 6 and insertion of 26 nucleotides causing a translational frameshift at position 698 with a predicted alternate stop codon after 59 amino acids. This alteration occurs at the 3' terminus of the AK2 gene, is not expected to trigger nonsense-mediated mRNA decay and results in the elongation of the protein by 51 amino acids. This frameshift impacts the last 7 (2.9%) amino acids of the native protein. The exact functional effect of the altered amino acids is unknown. This variant was not reported in population-based cohorts in the Genome Aggregation Database (gnomAD). Based on insufficient or conflicting evidence, the clinical significance of this alteration remains unclear. (less)

Comment:

The c.698_703delinsGACTCATAAACATAAACATAAACTCA (p.K233Rfs*59) alteration, located in exon 6 (coding exon 6) of the AK2 gene, consists of a deletion of 6 and insertion of 26 nucleotides causing a translational frameshift at position 698 with a predicted alternate stop codon after 59 amino acids. This alteration occurs at the 3' terminus of the AK2 gene, is not expected to trigger nonsense-mediated mRNA decay and results in the elongation of the protein by 51 amino acids. This frameshift impacts the last 7 (2.9%) amino acids of the native protein. The exact functional effect of the altered amino acids is unknown. This variant was not reported in population-based cohorts in the Genome Aggregation Database (gnomAD). Based on insufficient or conflicting evidence, the clinical significance of this alteration remains unclear.

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

There are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar.

Text-mined citations for this variant ...

Record last updated Aug 11, 2024

ClinVar Genomic variation as it relates to human health

NM_001625.4(AK2):c.698_703delinsGACTCATAAACATAAACATAAACTCA (p.Lys233fs)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for this variant ...