VCV000041697.33 - ClinVar

NM_000368.5(TSC1):c.3112AGC[7] (p.Ser1043dup)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(11)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Benign/Likely benign

criteria provided, multiple submitters, no conflicts

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_000368.5(TSC1):c.3112AGC[7] (p.Ser1043dup)

Variation ID: 41697 Accession: VCV000041697.33

Type and length

Microsatellite, 3 bp

Location

Cytogenetic: 9q34.13 9: 132896600-132896601 (GRCh38) [ NCBI UCSC ] 9: 135771987-135771988 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Apr 12, 2013	Oct 20, 2024	Jul 1, 2024

HGVS

Nucleotide	Protein	Molecular consequence
NM_000368.5:c.3112AGC[7] MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_000359.1:p.Ser1043dup	inframe insertion
NM_000368.5:c.3127_3129dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NM_000368.5:c.3127_3129dupAGC MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NM_000368.4:c.3127_3129dupAGC		inframe insertion
NM_001162426.2:c.3109AGC[7]	NP_001155898.1:p.Ser1042dup	inframe insertion
NM_001162427.2:c.2959AGC[7]	NP_001155899.1:p.Ser992dup	inframe insertion
NM_001362177.2:c.2749AGC[7]	NP_001349106.1:p.Ser922dup	inframe insertion
NC_000009.12:g.132896603TGC[7]
NC_000009.11:g.135771990TGC[7]
NG_012386.1:g.53016AGC[7]
LRG_486:g.53016AGC[7]

... more HGVS ... less HGVS

Protein change

Other names

Canonical SPDI

NC_000009.12:132896600:GCTGCTGCTGCTGCTGCTGC:GCTGCTGCTGCTGCTGCTGCTGC

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

ClinGen: CA215768 Tuberous sclerosis database (TSC1): TSC1_00373 dbSNP: rs2234980 VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
TSC1		Sufficient evidence for dosage pathogenicity	No evidence available	GRCh38 GRCh37	4848	4906

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
not provided	Benign/Likely benign (4)	criteria provided, multiple submitters, no conflicts	Jul 1, 2024	RCV000034610.24
Tuberous sclerosis syndrome	not provided (1)	no classification provided	-	RCV000054843.2
Tuberous sclerosis 1	Benign/Likely benign (3)	criteria provided, multiple submitters, no conflicts	Feb 1, 2024	RCV001080890.8
not specified	Benign (1)	criteria provided, single submitter	Jan 20, 2022	RCV001824583.1
Hereditary cancer-predisposing syndrome	Benign (2)	criteria provided, multiple submitters, no conflicts	Aug 7, 2020	RCV002255261.3

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Benign (Mar 03, 2015)	criteria provided, single submitter (GeneDx Variant Classification Process June 2021) Method: clinical testing	Not Provided Affected status: yes Allele origin: germline	GeneDx Accession: SCV001860152.1 First in ClinVar: Sep 19, 2021 Last updated: Sep 19, 2021
Benign (Feb 01, 2024)	criteria provided, single submitter (Invitae Variant Classification Sherloc (09022015)) Method: clinical testing	Tuberous sclerosis 1 Affected status: unknown Allele origin: germline	Labcorp Genetics (formerly Invitae), Labcorp Accession: SCV000284717.10 First in ClinVar: Jul 01, 2016 Last updated: Feb 20, 2024
Benign (Jan 20, 2022)	criteria provided, single submitter (LabCorp Variant Classification Summary - May 2015) Method: clinical testing	not specified Affected status: unknown Allele origin: germline	Women's Health and Genetics/Laboratory Corporation of America, LabCorp Accession: SCV002074363.1 First in ClinVar: Feb 12, 2022 Last updated: Feb 12, 2022	Publications: PubMed (1) PubMed: 11013456 Comment: Variant summary: TSC1 c.3127_3129dupAGC (p.Ser1043dup) results in an in-frame duplication of one serine residue that expands a repeat consisting of 6 serines to 7. The … (more) Variant summary: TSC1 c.3127_3129dupAGC (p.Ser1043dup) results in an in-frame duplication of one serine residue that expands a repeat consisting of 6 serines to 7. The variant allele was found at a frequency of 0.00064 in 245184 control chromosomes (gnomAD). The observed variant frequency is approximately 25 fold of the estimated maximal expected allele frequency for a pathogenic variant in TSC1 causing Tuberous Sclerosis Complex phenotype (2.5e-05), strongly suggesting that the variant is benign. The variant, c.3127_3129dupAGC, has been reported in the literature in 2 Japanese individuals affected with Tuberous Sclerosis Complex, however, at least one of these individuals was noted to carry a co-occurring nonsense mutation, which could explain the phenotype, in addition the variant was also found in 3/100 healthy Japanese controls (Pipo_2000). To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. Three clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014 and classified the variant as benign (n=2) and likely benign(n=1). Based on the evidence outlined above, the variant was classified as benign. (less)
Benign (Aug 21, 2023)	criteria provided, single submitter (Quest Diagnostics criteria) Method: clinical testing	not provided Affected status: unknown Allele origin: unknown	Quest Diagnostics Nichols Institute San Juan Capistrano Accession: SCV004221393.1 First in ClinVar: Jan 06, 2024 Last updated: Jan 06, 2024	Publications: PubMed (2) PubMed: 11013456‚ 22703879
Benign (Sep 30, 2022)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Tuberous sclerosis 1 Affected status: unknown Allele origin: germline	Color Diagnostics, LLC DBA Color Health Accession: SCV004360797.1 First in ClinVar: Feb 14, 2024 Last updated: Feb 14, 2024
Likely benign (Jul 01, 2024)	criteria provided, single submitter (CeGaT Center For Human Genetics Tuebingen Variant Classification Criteria Version 2) Method: clinical testing	not provided Affected status: yes Allele origin: germline	CeGaT Center for Human Genetics Tuebingen Accession: SCV002585094.15 First in ClinVar: Oct 22, 2022 Last updated: Oct 20, 2024	Comment: TSC1: BS1 Number of individuals with the variant: 15
Likely benign (Jul 10, 2020)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Tuberous sclerosis 1 Affected status: yes Allele origin: germline	Division of Genomic Medicine, Department of Advanced Medicine, Medical Research Institute, Kanazawa Medical University Accession: SCV001430707.1 First in ClinVar: Aug 23, 2020 Last updated: Aug 23, 2020	Number of individuals with the variant: 2 Ethnicity/Population group: Japanese
Benign (Aug 07, 2020)	criteria provided, single submitter (Ambry Variant Classification Scheme 2023) Method: clinical testing	Hereditary cancer-predisposing syndrome Affected status: unknown Allele origin: germline	Ambry Genetics Accession: SCV002607963.2 First in ClinVar: Nov 29, 2022 Last updated: May 01, 2024	Comment: This alteration is classified as benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation … (more) This alteration is classified as benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. (less)
Benign (Feb 24, 2020)	criteria provided, single submitter (Sema4 Curation Guidelines) Method: curation	Hereditary cancer-predisposing syndrome Affected status: unknown Allele origin: germline	Sema4, Sema4 Accession: SCV002531423.1 First in ClinVar: Jun 24, 2022 Last updated: Jun 24, 2022
probably not pathogenic (Jul 13, 2012)	no assertion criteria provided Method: research	not provided Affected status: no Allele origin: germline	Biesecker Lab/Clinical Genomics Section, National Institutes of Health Study: ClinSeq Accession: SCV000043506.1 First in ClinVar: Apr 12, 2013 Last updated: Apr 12, 2013	Publications: PubMed (1) PubMed: 22703879 Comment: Converted during submission to Likely benign. Number of individuals with the variant: 1 Comment on evidence: The study set was not selected for affection status in relation to any cancer. Pathogenicity categories were based on literature curation. See Pubmed ID:22703879 for … (more) The study set was not selected for affection status in relation to any cancer. Pathogenicity categories were based on literature curation. See Pubmed ID:22703879 for details. (less)
not provided (-)	no classification provided (Tuberous Sclerosis Database Assertion Criteria 2015) Method: curation	TSC Affected status: yes Allele origin: germline	Tuberous sclerosis database (TSC1) Accession: SCV000066054.3 First in ClinVar: May 03, 2013 Last updated: Sep 16, 2013
click to load more click to collapse

Comment:

Variant summary: TSC1 c.3127_3129dupAGC (p.Ser1043dup) results in an in-frame duplication of one serine residue that expands a repeat consisting of 6 serines to 7. The variant allele was found at a frequency of 0.00064 in 245184 control chromosomes (gnomAD). The observed variant frequency is approximately 25 fold of the estimated maximal expected allele frequency for a pathogenic variant in TSC1 causing Tuberous Sclerosis Complex phenotype (2.5e-05), strongly suggesting that the variant is benign. The variant, c.3127_3129dupAGC, has been reported in the literature in 2 Japanese individuals affected with Tuberous Sclerosis Complex, however, at least one of these individuals was noted to carry a co-occurring nonsense mutation, which could explain the phenotype, in addition the variant was also found in 3/100 healthy Japanese controls (Pipo_2000). To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. Three clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014 and classified the variant as benign (n=2) and likely benign(n=1). Based on the evidence outlined above, the variant was classified as benign.

Comment:

This alteration is classified as benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity.

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
Secondary variants in individuals undergoing exome sequencing: screening of 572 individuals identifies high-penetrance mutations in cancer-susceptibility genes.	Johnston JJ	American journal of human genetics	2012	PMID: 22703879
Two novel serine repeat length polymorphisms (1043insS and 1043insSS) at exon 23 of the TSC1 gene.	Pipo JR	Human mutation	2000	PMID: 11013456

Text-mined citations for rs2234980 ...

These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Oct 20, 2024

ClinVar Genomic variation as it relates to human health

NM_000368.5(TSC1):c.3112AGC[7] (p.Ser1043dup)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for rs2234980 ...