VCV000004459.2 - ClinVar

NM_052945.4(TNFRSF13C):c.265_288del (p.Leu89_Val96del)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(1)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Pathogenic

no assertion criteria provided

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_052945.4(TNFRSF13C):c.265_288del (p.Leu89_Val96del)

Variation ID: 4459 Accession: VCV000004459.2

Type and length

Deletion, 24 bp

Location

Cytogenetic: 22q13.2 22: 41926180-41926203 (GRCh38) [ NCBI UCSC ] 22: 42322184-42322207 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Apr 4, 2013	May 26, 2024	Aug 18, 2009

HGVS

Nucleotide	Protein	Molecular consequence
NM_052945.4:c.265_288del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_443177.1:p.Leu89_Val96del	inframe deletion
NM_052945.3:c.265_288del24	NP_443177.1:p.Leu89_Val96del	inframe indel
NC_000022.11:g.41926180_41926203del
NC_000022.10:g.42322184_42322207del
NG_007579.1:g.5615_5638del
LRG_184:g.5615_5638del
LRG_184t1:c.265_288del

... more HGVS ... less HGVS

Protein change

Other names

Canonical SPDI

NC_000022.11:41926179:CACCAGGACCAGCGCCAGGACCAG:

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

OMIM: 606269.0001 VarSome

Comment on variant

NCBI staff provided HGVS expressions for allelic variant 606269.0001 based on the assumption that the deletion corresponded to complete codons.

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
LOC130067574	-	-	-	GRCh38	-	115
TNFRSF13C		-	-	GRCh38 GRCh37	55	191

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
Immunodeficiency, common variable, 4	Pathogenic (1)	no assertion criteria provided	Aug 18, 2009	RCV000004713.3

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Pathogenic (Aug 18, 2009)	no assertion criteria provided Method: literature only	IMMUNODEFICIENCY, COMMON VARIABLE, 4 (1 family) Affected status: not provided Allele origin: germline	OMIM Accession: SCV000024888.2 First in ClinVar: Apr 04, 2013 Last updated: May 26, 2024	Publications: PubMed (1) PubMed: 19666484 Comment on evidence: In 2 sibs, born of consanguineous parents, with adult-onset common variable immunodeficiency-4 (613494), Warnatz et al. (2009) identified a homozygous 24-bp in-frame deletion (del89_96) in … (more) In 2 sibs, born of consanguineous parents, with adult-onset common variable immunodeficiency-4 (613494), Warnatz et al. (2009) identified a homozygous 24-bp in-frame deletion (del89_96) in exon 2 of the TNFRSF13C gene, resulting in the removal of a stretch of 8 hydrophobic amino acids from the transmembrane region. The mutation was not found in 100 controls. The mutant protein was not identified in immortalized patient lymphocytes, indicating that it was likely unstable. The proband was a 57-year-old man with a lifelong history of chronic sinusitis and adult-onset recurrent pneumonia. His 80-year-old sister had an unremarkable medical history except for a severe Herpes zoster infection at age 70. Laboratory studies of both patients showed very low serum IgG and IgM, but normal mucosal IgA. Both individuals also had a severe and persistent B-cell lymphopenia and reduced numbers of class-switched memory B cells. Surface protein phenotyping of the B cells showed a developmental arrest after the transitional stage and before the cells became mature follicular B cells. In vitro functional expression studies showed that the mutant protein failed to bind BAFF (603969) and failed to induce downstream NFKB (164011) processing. Warnatz et al. (2009) emphasized the phenotypic differences in the patients, which suggested residual sufficient potential to develop B cells that can differentiate and provide host defense even in the absence of BAFFR function. (less)

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
B-cell activating factor receptor deficiency is associated with an adult-onset antibody deficiency syndrome in humans.	Warnatz K	Proceedings of the National Academy of Sciences of the United States of America	2009	PMID: 19666484

Text-mined citations for this variant ...

Record last updated May 27, 2024

ClinVar Genomic variation as it relates to human health

NM_052945.4(TNFRSF13C):c.265_288del (p.Leu89_Val96del)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for this variant ...