VCV000523645.4 - ClinVar

NC_000019.10:g.17406024_17406025insAGTCTGGGGGCGGGGCCTG

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(1)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

association

no assertion criteria provided

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NC_000019.10:g.17406024_17406025insAGTCTGGGGGCGGGGCCTG

Variation ID: 523645 Accession: VCV000523645.4

Type and length

Insertion, 19 bp

Location

Cytogenetic: 19p13.11 19: 17406017-17406018 (GRCh38) [ NCBI UCSC ] 19: 17516826-17516827 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Aug 17, 2018	Aug 17, 2018

HGVS

Nucleotide	Protein	Molecular consequence
NM_001304547.2:c.-406-53_-406-52insAGTCTGGGGGCGGGGCCTG		intron variant
NC_000019.10:g.17406024_17406025insAGTCTGGGGGCGGGGCCTG
NC_000019.9:g.17516833_17516834insAGTCTGGGGGCGGGGCCTG
NG_198350.1:g.463_464insAGTCTGGGGGCGGGGCCTG

Protein change

Other names

Canonical SPDI

NC_000019.10:17406017:GGGCCTG:GGGCCTGAGTCTGGGGGCGGGGCCTG

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

effect on regulatory function of DNA; Variation Ontology [ VariO:0152]

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

dbSNP: rs1555734052 VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
BISPR	-	-	-	GRCh38	-	7
BST2		-	-	GRCh38 GRCh37	8	26
LOC130063933	-	-	-	GRCh38	-	7
MVB12A	-	-	-	GRCh38 GRCh37	22	45

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
Human immunodeficiency virus type 1, rapid progression to AIDS	association (1)	no assertion criteria provided	-	RCV000677265.11

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
association (-)	no assertion criteria provided Method: research	Human immunodeficiency virus type 1, rapid progression to AIDS Affected status: yes Allele origin: somatic	National AIDS Research Institute, National AIDS Research Institute Accession: SCV000611710.1 First in ClinVar: Aug 17, 2018 Last updated: Aug 17, 2018	Number of individuals with the variant: 1 Ethnicity/Population group: Indian

Germline Functional Evidence

Functional Help The functional consequence of the variant, based on experimental evidence and provided by the submitter. consequence	Method Help A brief description of the method used to determine the functional consequence of the variant. A citation for the method is included, when provided by the submitter.	Result Help A brief description of the result of this method for this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting functional evidence for the germline classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
effect on regulatory function of DNA (VariO:0152)	Method not provided	Result not provided	National AIDS Research Institute, National AIDS Research Institute Accession: SCV000611710.1

Citations for germline classification of this variant

There are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar.

Text-mined citations for rs1555734052 ...

These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Dec 15, 2024

ClinVar Genomic variation as it relates to human health

NC_000019.10:g.17406024_17406025insAGTCTGGGGGCGGGGCCTG

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for rs1555734052 ...