nsv7093520
- Organism: Homo sapiens
- Study:nstd102 (Clinical Structural Variants)
- Variant Type:insertion
- Method Type:Multiple
- Submitted on:GRCh37, GRCh38
- Variant Calls:1
- Validation:Not tested
- Clinical Assertions: Yes
- Region Size:1
- Description:NM_022455.5(NSD1):c.5115_5116insTTTTTTTTTTTTTT
TTTTTTNNNNNNNNNNCTGACCTCGTGATCCGCCCGCCTCGGCCTCCCAAAGTGCTGG
GATTACAGGCGTGAGCCACCGCGCCCGGCCATGAGCATGTT (p.Asn1706delinsPhePhePhePhePhePheXaaXaaXaaXaaLeuThrSerTer) AND Sotos syndrome - Publication(s):Tatton-Brown et al. 2004
- Genome View
- Variant Region Details and Evidence
- Validation Information
- Clinical Assertions
- Genotype Information
Genome View
Select assembly:Overlapping variant regions from other studies: 88 SVs from 31 studies. See in: genome view
Overlapping variant regions from other studies: 88 SVs from 31 studies. See in: genome view
Variant Region Placement Information
| Variant Region ID | Placement Type | Assembly | Assembly Unit | Sequence ID | Chr | Start | Stop |
|---|---|---|---|---|---|---|---|
| nsv7093520 | Submitted genomic | GRCh38 (hg38) | Primary Assembly | NC_000005.10 | Chr5 | 177,260,125 | 177,260,125 |
| nsv7093520 | Submitted genomic | GRCh37 (hg19) | Primary Assembly | NC_000005.9 | Chr5 | 176,687,126 | 176,687,126 |
Variant Call Information
| Variant Call ID | Type | Method | Analysis | Subject Phenotype | Clinical Interpretation | Source of Interpretation | ClinVar ID |
|---|---|---|---|---|---|---|---|
| nssv18830900 | insertion | Multiple | Multiple | SOTOS SYNDROME 1; SOTOS1; Sotos Syndrome; Sotos syndrome; Sotos syndrome | Pathogenic | ClinVar | RCV003232700.6, VCV002028009.2 |
Variant Call Placement Information
| Variant Call ID | Placement Type | HGVS | Assembly | Sequence ID | Chr | Start | Stop |
|---|---|---|---|---|---|---|---|
| nssv18830900 | Submitted genomic | NC_000005.10:g.177 260125_177260126in s113 | GRCh38 (hg38) | NC_000005.10 | Chr5 | 177,260,125 | 177,260,125 |
| nssv18830900 | Submitted genomic | NC_000005.9:g.1766 87126_176687127ins 113 | GRCh37 (hg19) | NC_000005.9 | Chr5 | 176,687,126 | 176,687,126 |
No validation data were submitted for this variant
Clinical Assertions
| Variant Call ID | HGVS | Type | Allele Origin | Subject Phenotype | Clinical Interpretation | Source of Interpretation | ClinVar ID |
|---|---|---|---|---|---|---|---|
| nssv18830900 | GRCh37: NC_000005.9:g.176687126_176687127ins113, GRCh38: NC_000005.10:g.177260125_177260126ins113 | insertion | germline | SOTOS SYNDROME 1; SOTOS1; Sotos Syndrome; Sotos syndrome; Sotos syndrome | Pathogenic | ClinVar | RCV003232700.6, VCV002028009.2 |