nsv3107792
- Organism: Homo sapiens
- Study:nstd144 (Gardner et al. 2017)
- Variant Type:mobile element insertion
- Method Type:Sequencing
- Submitted on:GRCh37 (hg19)
- Variant Calls:1
- Validation:Not tested
- Clinical Assertions: No
- Region Size:1
- Description:TSD=AAAAGTCTGACCTCAGATGG;MEINFO=SVA,520,1316,+
- Publication(s):Gardner et al. 2017
Source: NCBI
- Genome View
- Variant Region Details and Evidence
- Validation Information
- Clinical Assertions
- Genotype Information
Genome View
Select assembly:Overlapping variant regions from other studies: 116 SVs from 20 studies. See in: genome view
Overlapping variant regions from other studies: 116 SVs from 20 studies. See in: genome view
Variant Region Placement Information
| Variant Region ID | Placement Type | Score | Assembly | Assembly Unit | Reciprocity | Sequence ID | Chr | Start | Stop |
|---|---|---|---|---|---|---|---|---|---|
| nsv3107792 | Remapped | Perfect | GRCh38.p12 | Primary Assembly | First Pass | NC_000015.10 | Chr15 | 70,133,427 | 70,133,427 |
| nsv3107792 | Submitted genomic | GRCh37 (hg19) | Primary Assembly | NC_000015.9 | Chr15 | 70,425,766 | 70,425,766 |
Variant Call Information
| Variant Call ID | Type | Method | Analysis |
|---|---|---|---|
| nssv14069566 | sva insertion | Sequencing | Split read and paired-end mapping |
Variant Call Placement Information
| Variant Call ID | Placement Type | Score | HGVS | Assembly | Reciprocity | Sequence ID | Chr | Start | Stop |
|---|---|---|---|---|---|---|---|---|---|
| nssv14069566 | Remapped | Perfect | NC_000015.10:g.701 33427_70133428ins7 96 | GRCh38.p12 | First Pass | NC_000015.10 | Chr15 | 70,133,427 | 70,133,427 |
| nssv14069566 | Submitted genomic | NC_000015.9:g.7042 5766_70425767ins79 6 | GRCh37 (hg19) | NC_000015.9 | Chr15 | 70,425,766 | 70,425,766 |
No validation data were submitted for this variant
No clinical assertion data were submitted for this variant
Genotype Information
| Variant Call ID | Allele Frequency (AF) |
|---|---|
| nssv14069566 | 0.004 |