nsv6314574
- Organism: Homo sapiens
- Study:nstd102 (Clinical Structural Variants)
- Variant Type:insertion
- Method Type:Multiple
- Submitted on:GRCh37, GRCh38
- Variant Calls:1
- Validation:Not tested
- Clinical Assertions: Yes
- Region Size:1
- Description:NM_000314.8(PTEN):c.437_438insTTTTTTTTTTTTTTTN
NNNNNNNNNGGATGGTCTCGATCTCCTGACCTCGTGATCCGCCCGCCTCGGCCTCCCA
AAGTGCTGGGATTACAGGCGTGAGCCACCGCGCCCGGCCACATCGGGGCAAATTTTT (p.Leu146delinsPhePhePhePhePheXaaXaaXaaXaaGlyTrpSerArgSerProAspLeuValIleArgProProArgProProLysValLeuGlyLeuGlnAlaTer) AND PTEN hamartoma tumor syndrome - Publication(s):ACMG Board of Directors et al. 2014, Daly et al. 2014, Eng et al. 2001, Green et al. 2013, Kalia et al. 2016, No authors et al. 2020, No authors et al. 2021, No authors et al. 2021, No authors et al. 2021, Saslow et al. 2007, Schaefer et al. 2013, Syngal et al. 2015
- ClinVar: RCV001916894.4
- ClinVar: VCV001421391.4
- GeneReviews: NBK1488
- MONDO: 0017623
- MeSH: D006223
- MedGen: C1959582
- PubMed: 17392385
- PubMed: 20301661
- PubMed: 23519317
- PubMed: 23788249
- PubMed: 25190698
- PubMed: 25356965
- PubMed: 25645574
- PubMed: 26389210
- PubMed: 26389258
- PubMed: 26389333
- PubMed: 26389505
- PubMed: 27854360
- Overlapping Genes
Source: NCBI
- Genome View
- Variant Region Details and Evidence
- Validation Information
- Clinical Assertions
- Genotype Information
Genome View
Select assembly:Overlapping variant regions from other studies: 85 SVs from 19 studies. See in: genome view
Overlapping variant regions from other studies: 85 SVs from 19 studies. See in: genome view
Variant Region Placement Information
Variant Region ID | Placement Type | Assembly | Assembly Unit | Sequence ID | Chr | Start | Stop |
---|---|---|---|---|---|---|---|
nsv6314574 | Submitted genomic | GRCh38 (hg38) | Primary Assembly | NC_000010.11 | Chr10 | 87,933,178 | 87,933,178 |
nsv6314574 | Submitted genomic | GRCh37 (hg19) | Primary Assembly | NC_000010.10 | Chr10 | 89,692,935 | 89,692,935 |
Variant Call Information
Variant Call ID | Type | Method | Analysis | Subject Phenotype | Clinical Interpretation | Source of Interpretation | ClinVar ID |
---|---|---|---|---|---|---|---|
nssv17974698 | insertion | Multiple | Multiple | Hamartoma Syndrome, Multiple; PTEN Hamartoma Tumor Syndrome; PTEN hamartoma tumor syndrome | Pathogenic | ClinVar | RCV001916894.4, VCV001421391.4 |
Variant Call Placement Information
Variant Call ID | Placement Type | HGVS | Assembly | Sequence ID | Chr | Start | Stop |
---|---|---|---|---|---|---|---|
nssv17974698 | Submitted genomic | NC_000010.11:g.879 33178_87933179ins1 31 | GRCh38 (hg38) | NC_000010.11 | Chr10 | 87,933,178 | 87,933,178 |
nssv17974698 | Submitted genomic | NC_000010.10:g.896 92935_89692936ins1 31 | GRCh37 (hg19) | NC_000010.10 | Chr10 | 89,692,935 | 89,692,935 |
No validation data were submitted for this variant
Clinical Assertions
Variant Call ID | HGVS | Type | Allele Origin | Subject Phenotype | Clinical Interpretation | Source of Interpretation | ClinVar ID |
---|---|---|---|---|---|---|---|
nssv17974698 | GRCh37: NC_000010.10:g.89692935_89692936ins131, GRCh38: NC_000010.11:g.87933178_87933179ins131 | insertion | germline | Hamartoma Syndrome, Multiple; PTEN Hamartoma Tumor Syndrome; PTEN hamartoma tumor syndrome | Pathogenic | ClinVar | RCV001916894.4, VCV001421391.4 |