Warning: The NCBI web site requires JavaScript to function. more...
An official website of the United States government
The .gov means it's official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you're on a federal government site.
The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.
Gene expression data from AP-2γ silenced MCF-7 cells
PubMed Full text in PMC Similar studies Analyze with GEO2R
Activator protein-2gamma silencing effect on MCF-7 breast tumor cell line
PubMed Full text in PMC Similar studies GEO Profiles Analyze DataSet
[HG-U133_Plus_2] Affymetrix Human Genome U133 Plus 2.0 Array
Non-silencing control siRNA: AAUUCUCCGAACGUGUCACGU Technical Replicate 2
Filters: Manage Filters
Your browsing activity is empty.
Activity recording is turned off.
Turn recording back on