GEO DataSets

(Submitter supplied) Hairy vetch (Vicia villosa Roth) is recognized as a beneficial winter cover crop in the Midwestern U.S. DNA microarrays are used for assessing gene expression significance. The objective of the study was to identify a set of genes expressed in hairy vetch, that could be further analyzed for their potential in improving the crop. The RNA of four targets (soybean (Glycine max), hairy vetch, Vicia pannonica PI 170008, and Vicia pannonica PI 515988) were purified, labeled, and hybridized to 142 cDNA clones of biotic stress genes and gene sequences of soybean that were robotically spotted onto aminosilicated slides with duplicate spots and three arrays per slide. more...

Organism:

Vicia villosa; Glycine max; Vicia pannonica

Type:

Expression profiling by array

Platform:

GPL2665

41 Samples

Download data

(Submitter supplied) Printer was a Cartesian Pyxis 5500 PCR primers: F NIA-M13F CCAGTCACGACGTTGTAAAACGAC R NIA-M13R GTGTGGAATTGTGAGCGGATAACAA PCR condition: 50 ul reactions 95oC 10 min 35 cycles of 95oC 40 sec, 65oC 40 sec, 72oC 3 min 72oC 5 min 4oC 1 min All products were run out on 1.5% agarose gels. Failed reactions were rerun and replaced. The entire reaction was cleaned on Sephadex columns in Whatman filter plates, transferred to a 384 well plate, dried down in a speedvac and resuspended in printing buffer. more...

Organism:

Glycine max; Vicia villosa; Vicia pannonica

1 Series

41 Samples

Download data