Expression pattern

• This gene is expressed at high level at all stages of development, embryos, L1, L2, L3, L4 larvae and aduts\; it is expressed at least in the soma, since the transcript is also found in large amounts in germ-line defective glp-4 animals [reviewed by Bartel D, Lau N, Lim L, oct 2003]

Molecular properties

• [Ambros et al, RNA 2003] MicroRNAs (miRNAs) are small noncoding RNA gene products 20 to 25 nt long that are processed by Dicer (with 5'-phosphate and 3'-hydroxyl) from single stranded precursors with a characteristic hairpin secondary structure. They cannot reliably be distinguished from other RNAs such as small interfering RNAs also processed by Dicer, through their function or structure, but they can through a combination of expression properties: a distinct ~22-nt RNA transcript should be detectable by hybridization to a size-fractionated RNA sample\; biogenesis : MicroRNAs come from a single-molecule fold-back (hairpin) structure, not a hybrid between two antiparallel transcripts, and finally, in organisms with reduced Dicer function, increased precursor accumulation should occur. In the best cases, phylogenetic conservation of the ~22-nt miRNA sequence and its predicted fold-back precursor secondary structure is observed across distant species.
• [Wormbase] mir-58 encodes a microRNA, a small non-protein coding RNA and is conserved in C. briggsae\; mir-58 is expressed constitutively throughout development in normal worms and in glp-4(bn2) adults\; many of the known microRNAs are involved in post-transcriptional regulation of genes\; the precise function of mir-58 is not known.
• [This gene is annotated in collaboration with Nelson Lau and David Bartel] The mature miRNA sequence UGAGAUCGUUCAGUACGGCAAU originates from the 3' end of the stem-loop sequence GCTCGTCATATCCATTGCCCTACTCTTCGCATCTCATCACTTCGTCCAATACCATAGGGATGAGATCGTTCAGTACGGCAATGGACTGAGCTAGAGT. The actual transcript is not known. The miRNA stem-loop sequence displayed corresponds to the foldback structure used to find and define the miRNAs and their homologs in other species. This miRNA is exactly conserved in C. briggsae (100\% identity).