U.S. flag

An official website of the United States government

Format

Send to:

Choose Destination

MIR171a [ Arabidopsis thaliana (thale cress) ]

Gene ID: 28719395, updated on 11-Sep-2024

Summary

Go to the top of the page Help
Official Symbol
MIR171a
Primary source
TAIR:AT3G51375
Locus tag
AT3G51375
See related
Araport:AT3G51375
Gene type
ncRNA
Organism
Arabidopsis thaliana (ecotype: Columbia)
Lineage
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; malvids; Brassicales; Brassicaceae; Camelineae; Arabidopsis
Also known as
microRNA171A; MIR171A; p_MI0000214
Summary
Encodes a microRNA that targets several SCL family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGAUUGAGCCGCGCCAAUAUC
NEW
Try the new Gene table
Try the new Transcript table

Genomic context

Go to the top of the page Help
See MIR171a in Genome Data Viewer
Location:
chromosome: 3
Exon count:
1
Sequence:
Chromosome: 3; NC_003074.8 (19073434..19073556)

Chromosome 3 - NC_003074.8Genomic Context describing neighboring genes Neighboring gene ncRNA Neighboring gene miscRNA Neighboring gene Protein phosphatase 2C family protein Neighboring gene IQ-domain 20 Neighboring gene DHHC-type zinc finger family protein Neighboring gene hypothetical protein (DUF241)

Genomic regions, transcripts, and products

Go to the top of the page Help
Genomic Sequence:
NC_003074.8

Go to nucleotide: Graphics FASTA GenBank

Bibliography

Go to the top of the pageHelp

Related articles in PubMed

  1. miRNAs control HAM1 functions at the single-cell-layer level and are essential for normal embryogenesis in Arabidopsis. Takanashi H, et al. Plant Mol Biol, 2018 Apr. PMID 29574557
  2. Computational identification of plant microRNAs and their targets, including a stress-induced miRNA. Jones-Rhoades MW, et al. Mol Cell, 2004 Jun 18. PMID 15200956

GeneRIFs: Gene References Into Functions

What's a GeneRIF?
  1. Results indicate that the control of HAIRY MERISTEM 1 (HAM1) functions at the single-cell-layer level by miR171a is essential for proper organ formation.
    Title: miRNAs control HAM1 functions at the single-cell-layer level and are essential for normal embryogenesis in Arabidopsis.
Submit: New GeneRIF Correction

General gene information

Go to the top of the page Help
  • mature miRNA accession:MIMAT0000202
  • mature miRNA accession:MIMAT0031888

Gene Ontology Provided by TAIR

Function Evidence Code Pubs
enables molecular_function ND
No biological Data available
more info
  
Process Evidence Code Pubs
acts_upstream_of_or_within miRNA-mediated post-transcriptional gene silencing TAS
Traceable Author Statement
more info
 PubMed 
Component Evidence Code Pubs
is_active_in cellular_component ND
No biological Data available
more info
  

NCBI Reference Sequences (RefSeq)

Go to the top of the page Help

NEW Try the new Transcript table

Genome Annotation

The following sections contain reference sequences that belong to a specific genome build. Explain

Reference assembly

Genomic

  1. NC_003074.8 Reference assembly

    Range
    19073434..19073556
    Download
    GenBank, FASTA, Sequence Viewer (Graphics)

RNA

  1. NR_141671.1 RNA Sequence

    Status: REVIEWED

Gene LinkOut

The following LinkOut resources are supplied by external providers. These providers are responsible for maintaining the links.

Molecular Biology Databases