| Neurodevelopmental disorder in a patient with HMBS and SCN3A variants-A possibly blended phenotype further delineating autosomal recessive HMBS related disease. | Neurodevelopmental disorder in a patient with HMBS and SCN3A variants-A possibly blended phenotype further delineating autosomal recessive HMBS related disease.
M K, M R, J B, A BI, K IP, R W, E O, A ZK, R S, R P. | 07/26/2024 |
| Identification and molecular analysis of 17 novel variants of hydroxymethylbilane synthase in Chinese patients with acute intermittent porphyria. | Identification and molecular analysis of 17 novel variants of hydroxymethylbilane synthase in Chinese patients with acute intermittent porphyria.
Hu Y, Li W, Kang N, Ma L, Teng Q, Mo G, Wu J, Wang X, Bi R, Zhang S. | 05/21/2022 |
| Expanding the clinical and radiological phenotypes of leukoencephalopathy due to biallelic HMBS mutations. | Expanding the clinical and radiological phenotypes of leukoencephalopathy due to biallelic HMBS mutations.
Stutterd CA, Kidd A, Florkowski C, Janus E, Fanjul M, Raizis A, Wu TY, Archer J, Leventer RJ, Amor DJ, Lukic V, Bahlo M, Gow P, Lockhart PJ, van der Knaap MS, Delatycki MB. | 01/22/2022 |
| Two Novel Hydroxymethylbilane Synthase Splicing Mutations Predispose to Acute Intermittent Porphyria. | Two Novel Hydroxymethylbilane Synthase Splicing Mutations Predispose to Acute Intermittent Porphyria.
Zhang Y, Xiao H, Xiong Q, Wu C, Li P., Free PMC Article | 01/1/2022 |
| Brain ventricular enlargement in human and murine acute intermittent porphyria. | Brain ventricular enlargement in human and murine acute intermittent porphyria.
Jericó D, Luis EO, Cussó L, Fernández-Seara MA, Morales X, Córdoba KM, Benito M, Sampedro A, Larriva M, Ramírez MJ, de Salamanca RE, Ortiz-de-Solorzano C, Alegre M, Prieto J, Lanciego JL, D'Avola D, González-Aseguinolaza G, Pastor MA, Desco M, Fontanellas A. | 09/4/2021 |
| Mount Sinai Porphyrias Diagnostic Laboratory diagnosed 315 unrelated Acute Intermittent Porphyria individuals with HMBS mutations, including 46 previously unreported mutations. | Acute hepatic porphyrias: Identification of 46 hydroxymethylbilane synthase, 11 coproporphyrinogen oxidase, and 20 protoporphyrinogen oxidase novel mutations.
Loskove Y, Yasuda M, Chen B, Nazarenko I, Cody N, Desnick RJ. | 07/4/2020 |
| Identified 40 novel HMBS mutations in unrelated individuals with acute intermittent porphyria (AIP); all mutants had less than 5% of expressed wildtype activity, except for c.1039G>C (p.A347P), which had 51% residual HMBS activity. Mutations near the active site or at the dimerization interface resulted in stably expressed proteins, while most that altered surface residues resulted in unstable protein. | Identification and characterization of 40 novel hydroxymethylbilane synthase mutations that cause acute intermittent porphyria.
Chen B, Solis-Villa C, Erwin AL, Balwani M, Nazarenko I, Phillips JD, Desnick RJ, Yasuda M., Free PMC Article | 06/6/2020 |
| To investigate the dramatically different manifestations, knock-in mice with human homozygous dominant-Acute intermittent porphyria (HD-AIP) missense mutations c.500G>A (p.Arg167Glu) or c.518_519GC>AG (p.Arg173Glu), designated R167Q or R173Q mice, respectively, were generated and compared with the previously established T1/T2 mice with ~30% residual HMBS activity and the heterozygous AIP phenotype | Homozygous hydroxymethylbilane synthase knock-in mice provide pathogenic insights into the severe neurological impairments present in human homozygous dominant acute intermittent porphyria.
Yasuda M, Gan L, Chen B, Yu C, Zhang J, Gama-Sosa MA, Pollak DD, Berger S, Phillips JD, Edelmann W, Desnick RJ., Free PMC Article | 02/8/2020 |
| Using two bioinformatics pipelines for analysis of RNA fingerprints we identified significant effects of E. coli on the mRNAs HMBS, ATP2C1 and LRCH4. To see whether these three proteins were present in platelets and were influenced by the bacteria, we analysed HMBS, ATP2C1 and LRCH4 in platelet lysates and releasates by Western blot and ELISA. | Impact of Escherichia coli K12 and O18:K1 on human platelets: Differential effects on platelet activation, RNAs and proteins.
Fejes AV, Best MG, van der Heijden WA, Vancura A, Verschueren H, de Mast Q, Wurdinger T, Mannhalter C., Free PMC Article | 10/26/2019 |
| In the present study, we identified four HMBS gene mutations affecting the ubiquitous isoform of porphobilinogen deaminase (PBGD) and established a dPCR protocol which would be able to detect the different transcripts of this gene. | Molecular characterization, by digital PCR analysis of four HMBS gene mutations affecting the ubiquitous isoform of Porphobilinogen Deaminase (PBGD) in patients with Acute Intermittent Porphyria (AIP).
Granata F, Mendez M, Brancaleoni V, Castelbon FJ, Graziadei G, Ventura P, Di Pierro E. | 06/22/2019 |
| Here we show that intravenous administration of human PBGD (hPBGD) mRNA (encoded by the gene HMBS) encapsulated in lipid nanoparticles induces dose-dependent protein expression in mouse hepatocytes, rapidly normalizing urine porphyrin precursor excretion in ongoing attacks | Systemic messenger RNA as an etiological treatment for acute intermittent porphyria.
Jiang L, Berraondo P, Jericó D, Guey LT, Sampedro A, Frassetto A, Benenato KE, Burke K, Santamaría E, Alegre M, Pejenaute Á, Kalariya M, Butcher W, Park JS, Zhu X, Sabnis S, Kumarasinghe ES, Salerno T, Kenney M, Lukacs CM, Ávila MA, Martini PGV, Fontanellas A. | 05/11/2019 |
| In a Chinese female patient with very typical Acute intermittent porphyria symptoms, a heterozygous mutation of the HMBS gene was identified in the proband and 7 other family members. Genetic sequencing showed a deletion of 55 basepairs (C.1078_1132delGCCCATTAACTGGTTTGTGGGGCACAGATGCCTGGGTTGCTGCTGTCCAGTGCCT) including the stop codon position, leading to frameshift mutation. | A novel 55-basepair deletion of hydroxymethylbilane synthase gene found in a Chinese patient with acute intermittent porphyria and her family: A case report.
Ren Y, Xu LX, Liu YF, Xiang CY, Gao F, Wang Y, Bai T, Yin JH, Zhao YL, Yang J., Free PMC Article | 09/29/2018 |
| Human hydroxymethylbilane synthase: Molecular dynamics of the pyrrole chain elongation identifies step-specific residues that cause acute intermittent porphyria. | Human hydroxymethylbilane synthase: Molecular dynamics of the pyrrole chain elongation identifies step-specific residues that cause AIP.
Bung N, Roy A, Chen B, Das D, Pradhan M, Yasuda M, New MI, Desnick RJ, Bulusu G., Free PMC Article | 08/18/2018 |
| After a diagnostic odyssey, his urine porphobilinogen was found to be significantly elevated and genetic testing showed a previously unreported consensus splice-site mutation IVS4-1G>A in the HMBS gene confirming the diagnosis of Acute Intermittent Porphyria (AIP) | Acute Intermittent Porphyria in children: A case report and review of the literature.
Balwani M, Singh P, Seth A, Debnath EM, Naik H, Doheny D, Chen B, Yasuda M, Desnick RJ., Free PMC Article | 12/16/2017 |
| The authors describe the biochemical characterisation of expressed HMBS mutants in a black South African population. This reveals insight into the mechanism of catalytic activity loss, which may inspire investigation into individualised therapy based on the molecular lesion identified. | Molecular characterisation of acute intermittent porphyria in a cohort of South African patients and kinetic analysis of two expressed mutants.
Fortgens P, Pienaar E, Corrigall A, Sonderup M, Spearman CW, Meissner P. | 08/19/2017 |
| ALAS1 mRNA and activity were elevated approximately ~3- and 5-fold, and HMB synthase activity was approximately half-normal (~42%) | Liver Transplantation for Acute Intermittent Porphyria: Biochemical and Pathologic Studies of the Explanted Liver.
Yasuda M, Erwin AL, Liu LU, Balwani M, Chen B, Kadirvel S, Gan L, Fiel MI, Gordon RE, Yu C, Clavero S, Arvelakis A, Naik H, Martin LD, Phillips JD, Anderson KE, Sadagoparamanujam VM, Florman SS, Desnick RJ., Free PMC Article | 06/11/2016 |
| A new mutation in intron 2 (IVS2-2Ag-->G) was identified in a Chinese family with acute intermittent porphyria. | A novel mutation, IVS2-2AgG, associated with acute intermittent porphyria in a Chinese family.
Jiao H, Xianfeng Z, Hui H, MaLizhen, Yuhong Z, Chu Z. | 01/2/2016 |
| in the hepatic cancer tissue of two acute porphyria patients, somatic second-hit mutations result in nearly complete inactivation of PPOX and HMBS | Biallelic inactivation of protoporphyrinogen oxidase and hydroxymethylbilane synthase is associated with liver cancer in acute porphyrias.
Schneider-Yin X, van Tuyll van Serooskerken AM, Siegesmund M, Went P, Barman-Aksözen J, Bladergroen RS, Komminoth P, Cloots RH, Winnepenninckx VJ, zur Hausen A, Weber M, Driessen A, Poblete-Gutiérrez P, Bauer P, Schroeder C, van Geel M, Minder EI, Frank J. | 12/12/2015 |
| study of hydroxymethylbilane synthase mutations and polymorphisms in Brazilian families with acute intermittent porphyria | Hydroxymethylbilane synthase gene mutations and polymorphisms in Brazilian families with acute intermittent porphyria.
Gonzaga AD, de Amorim LM, Fonseca AB, Nogueira TL, Pereira OM, Nagai MA, de Oliveira Barretto OC, Ribeiro GS. | 11/14/2015 |
| Letter/Case Report: R173W mutation of HMBS gene can cause rhabdomyolysis in patients with variant acute intermittent porphyria. | R173W mutation of hydroxymethylbilane synthetase is associated with acute intermittent porphyria complicated with rhabdomyolysis: the first report.
Chen MC, Chang CJ, Lu YH, Niu DM, Lou HY, Chang CC. | 10/31/2015 |
| we report a novel PBGD missense mutation. | A novel mutation in the porphobilinogen deaminase gene in an extended Chinese family with acute intermittent porphyria.
Yang J, Wang H, Yin K, Hua B, Zhu T, Zhao Y, Guo S, Yu X, Wu W, Zhou Z. | 08/8/2015 |
| Novel porphobilinogen deaminase gene mutations have been described in Polish patients with non-erythroid acute intermittent porphyria. | Porphobilinogen deaminase gene mutations in Polish patients with non-erythroid acute intermittent porphyria.
Szlendak U, Lipniacka A, Bianketti J, Podolak-Dawidziak M, Bykowska K. | 06/6/2015 |
| Conformational stability and activity of hydroxymethylbilane synthase (HMSB) and the acute intermittent porphyria K132N and V215E HMSB mutations. | Conformational stability and activity analysis of two hydroxymethylbilane synthase mutants, K132N and V215E, with different phenotypic association with acute intermittent porphyria.
Bustad HJ, Vorland M, Rønneseth E, Sandberg S, Martinez A, Toska K., Free PMC Article | 04/26/2014 |
| Dense geographic aggregation with one identical haplotype strongly suggests a remote founder phenomenon for these Venezuelan acute intermittent porphyria families, carrying an unreported but most frequent HMBS mutation. | Marked geographic aggregation of acute intermittent porphyria families carrying mutation Q180X in Venezuelan populations, with description of further mutations.
Paradisi I, Arias S. | 04/12/2014 |
| Findings indicate that using TATA-binding protein (TBP) alone or in combination with hydroxymethylbilane synthase (HMBS) as endogenous controls could be a reliable method for normalizing qRT-PCR data in hepatoma cell lines treated with TNF-alpha. | Evaluation of potential reference genes for qRT-PCR studies in human hepatoma cell lines treated with TNF-α.
Wu C, Wang X, Zhong M, Liu H, He Q, Yang X, Wen J, Feng D. | 04/5/2014 |