|
| Status |
Public on Feb 14, 2014 |
| Title |
mRNA-seq Sal Rep1 |
| Sample type |
SRA |
| |
|
| Source name |
NAc dissection from 3-5 animals
|
| Organism |
Mus musculus |
| Characteristics |
passages: 8-10 weeks
strain: C57BL/6
treatment: Repeated saline I.P. injection for 1w as control
tissue: nucleus accumbens
|
| Treatment protocol |
N/A
|
| Growth protocol |
N/A
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Brain samples were homogenized in Trizol and processed according to the manufacturer's instructions. RNA was purified with RNeasy Micro columns and Bioanalyzer confirmed that the RNA RINs were >8.0. Four µg of total RNA were used for mRNA library construction following instructions of Illumina mRNA sample prep kit (cat#RS-100-0801). In brief, the poly-A containing mRNA was purified using poly-T oligo-attached magnetic beads. The mRNA was then fragmented into small pieces using divalent cations under elevated temperature. The cleaved RNA fragments were copied into first strand cDNA using reverse transcriptase and random primers. This was followed by second strand cDNA synthesis using DNA Polymerase I and RNaseH. These cDNA fragments went through an end repair process, the addition of a single 'A' base, and then ligation of the adapters. These products were gel purified and enriched with PCR to create the final cDNA libraries. The library constructs were run on the bioanalyzer to verify the size and concentration before sequencing on the Illumina HiSeq2000 machine at Mount Sinai's Genomic Core facility.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
all *.diff files from Cufflinks
|
| Data processing |
Basecalls performed using CASAVA
Adapter (AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG) sequences were removed from 3' end by fastx.
RNA-seq reads were aligned to the mm9 genome assembly using Tophat with options --frag-bias-correct and --multi-read-correct. Novel transcript assembly was not attempted.
Differential analysis was performed by Cuffdiff. An FDR<10% was used as cutoff.
Genome_build: mm9
Supplementary_files_format_and_content: A GTF file contains the structures of the transcripts assembled by Cufflinks.
Supplementary_files_format_and_content: Each .diff file produced by Cuffdiff is a tab-delimited text file that contains the differential analysis information for each item tested. The "sample_1" and "sample_2" refer to "saline_treated" and "cocaine_treated", respectively.
|
| |
|
| Submission date |
Dec 07, 2012 |
| Last update date |
May 15, 2019 |
| Contact name |
Li Shen |
| E-mail(s) |
[email protected]
|
| Organization name |
Icahn School of Medicine at Mount Sinai
|
| Department |
Neuroscience
|
| Lab |
Shen
|
| Street address |
1425 Madison Ave
|
| City |
New York |
| State/province |
NY |
| ZIP/Postal code |
10029 |
| Country |
USA |
| |
|
| Platform ID |
GPL13112 |
| Series (2) |
| GSE42805 |
Chronic cocaine-regulated epigenome in mouse [RNA-Seq] |
| GSE42811 |
Chronic cocaine-regulated epigenome in mouse |
|
| Relations |
| SRA |
SRX209158 |
| BioSample |
SAMN01827973 |
