|
| Status |
Public on Jan 01, 2017 |
| Title |
Mtr4_0_replicate2 |
| Sample type |
SRA |
| |
|
| Source name |
Mtr4 0
|
| Organism |
Saccharomyces cerevisiae |
| Characteristics |
sample type: crosslinked RNA
|
| Growth protocol |
Yeast cells were grown in SD -TRP media containing 2% glucose overnight and inoculated into fresh media at a starting OD600 of 0.05. Cells were grown for about 7 hours (until OD600=0.5) and either UV crosslinked (0 timepoint) or filtered and transferred to SD -TRP containing 2% glycerol and ethanol instead of glucose. Cells were UV crosslinked 4 or 8 minutes later.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Cells were lysed, followed by stringent, denaturing, two-step affinity purification of the tagged protein. Bound RNA was partially degraded with RNase, radiolabeled, and 5’ and 3’ linkers were added. Finally, covalent RNA-protein complexes were isolated by SDS-PAGE. Following Proteinase K digestion of the bound proteins, RNA fragments were amplified by RT-PCR.
RNA libraries were prepared using the standard CRAC protocol (Tuck and Tollervey, 2013)
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
Barcode: NNNCACTAGC
|
| Data processing |
Data was preprocessed using the fastx package. All sequences are of the form:
5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNXXXXXX==INSERT==TGGAATTCTCGGGTGCCAAGGCCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG-3’
where NNN are random nucleotides to assess for duplicates in PCR amplification and XXXXXX is a barcode to allow for multiplexing of different libraries. The barcode used for each sample is listed in the 'description' field.
Fastq files were split by barcode using pyBarcodeFilter.py in the pyCRAC package (Webb, et al, 2014). -m 0
Reads were aligned to the genome using Novoalign. -r Random
Reads were counted using pyReadCounter. --sense
Sequences were plotted along the genome using pyGTF2bedgraph
Genome_build: EF4.68
Supplementary_files_format_and_content: bedgraph or bigwig files showing the distribution of reads across the yeast genome
|
| |
|
| Submission date |
Sep 06, 2016 |
| Last update date |
May 15, 2019 |
| Contact name |
Stefan Bresson |
| E-mail(s) |
[email protected]
|
| Organization name |
University of Edinburgh
|
| Department |
Wellcome Trust Centre for Cell Biology
|
| Lab |
Tollervey Lab
|
| Street address |
Max Born Crescent, Swann 5.1
|
| City |
Edinburgh |
| State/province |
Scotland |
| ZIP/Postal code |
EH9 3BF |
| Country |
United Kingdom |
| |
|
| Platform ID |
GPL13821 |
| Series (1) |
| GSE86483 |
Nuclear RNA decay pathways aid rapid remodeling of gene expression in yeast |
|
| Relations |
| BioSample |
SAMN05732406 |
| SRA |
SRX2141155 |
