|
| Status |
Public on Jan 23, 2018 |
| Title |
BL4C-anchor1-rep1 |
| Sample type |
SRA |
| |
|
| Source name |
human immortalised myelogenous leukemia line
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: K562
4c viewpoint primer: GACGGAGTATTGCTTTTGTTG
|
| Growth protocol |
K562 cell line was cultured according to manufacturer's instructions
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Cells were cross-linked with formaldehyde and then nucleuses were isolated for lysis. Then the chromatin was fragmented with restriction enzymes HaeIII and the proximal ends were ligated with biotin-labeled bridge linker in situ. A whole genome chromatin was extracted and sheared into 300-500 bp. Then the biotinylated junctions were captured by M-280 streptavidin magnetic beads.
The DNA libraries were prepared according to the standard Illumina library construction protocol, including end repair, A-tailing and Y-adaptor ligation (annealing: 5P- GATCGGAAGAGCACACGTCTGAACTCCAGTCAC and TACACTCTTTCCCTACACGACGCTCTTCCGATCT). Then two rounds of PCR were followed: 4C viewpoint primer and adaptor sequence of I7 (GTGACTGGAGTTCAGACGTGT) for the first round, I5 with 4C viewpoint and I7 with barcodes for the second round. Then the libraries were sequenced on Illumina sequencer Hiseq X Ten.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
HiSeq X Ten |
| |
|
| Data processing |
Library strategy: 4C-seq
We used software ChIA-PET2 to process sequencing data, including linker trimming, reads alignment (BWA), paired-end tags formation and duplicates removal (parameters: -m 1 -k 2 -e 1 -A ACGCGATATCTTATC -B AGTCAGATAAGATAT).
Then the viewpoints interacted interactions were extracted from duplicates removed file *rmdup.bedpe and converted into bedgraph format.
Genome_build: GRCh37/hg19
Supplementary_files_format_and_content: bedGraph format: Chromosome, Start, End, Interaction counts
|
| |
|
| Submission date |
Aug 08, 2017 |
| Last update date |
May 15, 2019 |
| Contact name |
Zhengyu LIANG |
| E-mail(s) |
[email protected]
|
| Organization name |
Southern University of Science and Technology
|
| Department |
Department of Biology
|
| Lab |
Zhengyu Liang
|
| Street address |
1088 Xueyuan Avenue
|
| City |
Shenzhen |
| State/province |
Guangzhou |
| ZIP/Postal code |
518055 |
| Country |
China |
| |
|
| Platform ID |
GPL20795 |
| Series (1) |
| GSE93921 |
BL-Hi-C is an efficient and sensitive approach for capturing structural and regulatory chromatin interactions |
|
| Relations |
| BioSample |
SAMN07462511 |
| SRA |
SRX3073738 |
