|
| Status |
Public on Mar 22, 2019 |
| Title |
Undifferentiated keratinocytes, replicate 1 |
| Sample type |
SRA |
| |
|
| Source name |
human keratinocytes
|
| Organism |
Homo sapiens |
| Characteristics |
culture condition: 0.06mM Ca++ KBMGold+factors
|
| Treatment protocol |
Undifferentiated: Keratinocytes were cultured in low Ca++ KBMGold media for 4 days then collected for RNA isolation. Differentiated: After 2 days of culturing keratinocytes in low Ca++ GBMGold + factors, differentiation was started by chaning low Ca++ KBMGold medium to high Ca++ KBMGold medium. Media was changed every other day and differentiation was terminated at day 8 of differentiation.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA of about 4 μg was extracted using Trizol (ThermoFisher) and DNase (Ambion) then Ribo‐Zero (Illumina) treated. The remaining RNA fraction was bisulfite‐treated according to manufacturer's guidelines. Briefly, ribosomal depleted RNA was mixed with 70 μl of 40% sodium bisulfite pH 5.0 and DNA protection buffer (EpiTect Bisulfite Kit, Qiagen). The reaction mixture was incubated for three cycles of 5 min at 70°C followed by 1 h at 60°C and then desalted with Micro Bio‐spin 6 chromatography columns (Bio‐Rad). RNA was desulphonated by adding an equal volume of 1 M Tris (pH 9.0) to the reaction mixture and incubated for 1 h at 37°C, followed by ethanol precipitation. Bisulfite converted RNA was treated with T4 PNK (New England Biolabs) to repair both 5’ and 3’ ends for library preparation. Repaired RNA quality and concentration was measured on a Bioanalyzer 2100 RNA nano‐chip (Agilent).
About 100 ng of RNA was used to generate Bisulfite‐seq libraries. Libraries were performed according to TruSeq Small RNA preparation kit (Illumina). RNA adapters were then ligated, reverse‐transcribed followed by 18‐cycle PCR amplification before sequenced.
|
| |
|
| Library strategy |
Bisulfite-Seq |
| Library source |
transcriptomic |
| Library selection |
RANDOM |
| Instrument model |
Illumina HiSeq 4000 |
| |
|
| Data processing |
Trim Galore! v0.4.0 with parameters "--stringency 3 -e 0.2 -a TGGAATTCTCGGGTGCCAAGGA" was used to remove sequencing adapters.
Bismark v0.14.4 with parameters "-n 2 -l 50 --un --ambiguous --bowtie1 --chunkmbs 2048" was used to align the reads to the hg38 reference genome.
Seqtk with parameters "-e 3" was used to remove last three bases from unaligned and ambigous reads followed by re-alignment by Bismark.
Ngsutils v0.5.9 in the "junction" mode was used to extract splice junctions; unaligned reads from the previous alignment attempt were aligned to them using Bismark. The aligned reads were coverted back to genomic coordinates using bamutils in "convertregion" mode. 'N' in the cigar string was replaced with 'D' for compatibility with bismark_methylation_extractor.
Samtools merge was used to combine aligned reads from all steps. Reads with >1/3 methylated cytosines were discarded.
bismark_methylation_extractor with the "--bedGraph --counts --CX_context" options was used to extract methylated cytosines.
Genome_build: hg38
Supplementary_files_format_and_content: The bismark coverage reports are tab delimited and contain methylation level at each covered cytosine in the following format: <chromosome> <start position> <end position> <methylation percentage> <count methylated> <count unmethylated>
|
| |
|
| Submission date |
Nov 15, 2018 |
| Last update date |
Mar 25, 2019 |
| Contact name |
Susanne Bornelöv |
| Organization name |
University of Cambridge
|
| Department |
WT-MRC Cambridge Stem Cell Institute
|
| Street address |
Tennis Court Road
|
| City |
Cambridge |
| ZIP/Postal code |
CB2 1QR |
| Country |
United Kingdom |
| |
|
| Platform ID |
GPL20301 |
| Series (1) |
| GSE122600 |
Human keratinocytes RNA bisulfite sequencing |
|
| Relations |
| BioSample |
SAMN10433048 |
| SRA |
SRX5014531 |
