|
| Status |
Public on Apr 20, 2020 |
| Title |
HEK_Lib1_Enh_rep1 |
| Sample type |
SRA |
| |
|
| Source name |
HEK293FT cells
|
| Organism |
Homo sapiens |
| Characteristics |
oligo library: Library1
promoter type: Enhancer
cell line: HEK293FT cells
|
| Treatment protocol |
Cells were transfected with each MPRA libraries using Lipofectamine 3000 (Therme Scientific) and harvested at 24 hours after transfection for RNA isolation.
|
| Growth protocol |
UACC903 cells were grown in the medium containing RPMI1640, 10% FBS, 20 mM HEPES, and penicillin/streptomycin at 37C and 5% CO2. HEK293FT cells were grown in the medium containing DMEM, 10% FBS, and penicillin/streptomycin at the same condition
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was isolated using Qiagen RNeasy kit, and mRNA was subsequently isolated using PolyA purist MAG kit. cDNA was then synthesized using Superscript III
From input DNA library (before transfections) or cDNA output, short sequences encompassing 10bp unique barcodes were amplified using Q5 high-fidelity polymerase and primers introducing Illumina TruSeq adapter sequences
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Data processing |
Illumina Casava1.7 software used for basecalling and The BCL (base calls) binary is converted into FASTQ utilizing illumina package bcl2fastq
We counted the number of reads (Only use R1 read for tag count) completely matching 10bp barcode sequences (tag counts) and the same downstream sequence context (“TCTAGAATTATTACACGGCG”) including an XbaI recognition site and the 3’ of the luc2 gene.
Supplementary_files_format_and_content: Tag abundance measurements (Count,TPM,Ratio)
|
| |
|
| Submission date |
Apr 02, 2019 |
| Last update date |
Apr 20, 2020 |
| Contact name |
Kevin M Brown |
| Organization name |
National Cancer Institute
|
| Department |
Division of Cancer Epidemiology & Genetics
|
| Lab |
Laboratory of Translational Genomics
|
| Street address |
8717 Grovemont Circle
|
| City |
Gaithersburg |
| State/province |
MD |
| ZIP/Postal code |
20877 |
| Country |
USA |
| |
|
| Platform ID |
GPL16791 |
| Series (2) |
| GSE129242 |
Massively parallel reporter assays combined with cell-type specific eQTL identified a functional melanoma risk variant in HIV-1 restriction gene, MX2 [MPRA NGS] |
| GSE129250 |
Massively parallel reporter assays combined with cell-type specific eQTL identified a functional melanoma risk variant in HIV-1 restriction gene, MX2 |
|
| Relations |
| BioSample |
SAMN11318958 |
| SRA |
SRX5626556 |
