|
Status |
Public on May 06, 2022 |
Title |
Saline_3 |
Sample type |
SRA |
|
|
Source name |
Lung
|
Organism |
Mus musculus |
Characteristics |
strain: C57BL/6 genotype: WT treatment: Saline rin: 4
|
Treatment protocol |
Whole lung tissue lysate of mice treated with vehicle see above
|
Growth protocol |
see above
|
Extracted molecule |
polyA RNA |
Extraction protocol |
Total RNA was extracted from either the snap-frozen liver tissues or HSCs lysate using Trizol (Invitrogen) followed by RNeasy column (Qiagen) purification. Truseq Stranded mRNA (Poly A selection) kit
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina NextSeq 500 |
|
|
Description |
Whole Lung 3wks Saline treatment (Mouse) counts_mouse_ab
|
Data processing |
Sequenced libraries were demultiplexed using bcl2fastq v2.19.0.316 with the --no-lane-splitting option Adapter sequences were then trimmed using trimmomatic6 v0.36 in paired end mode with the options MAXINFO:35:0.5 MINLEN:35. For reference, the adapter sequences are: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA (read 1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read 2) Trimmed reads were aligned to human genome hg38 or mouse genome mm10 using STAR v. 2.2.1 with the options --outFilterType BySJout --outFilterMultimapNmax 20 --alignSJoverhangMin 8 --alignSJDBoverhangMin 1 --outFilterMismatchNmax 999 --alignIntronMin 20 --alignIntronMax 1000000 --alignMatesGapMax 1000000 in paired end, single pass mode. Only unique alignments were retained for counting. Counts were calculated at the gene level using the FeatureCounts module from subread v. 1.5.1, with the options -O -s 2 -J -T 8 -p -R -G. Genome_build: Homo sapiens hg38 Ensembl release 92 and Mus musculus mm10 Ensembl release 86 Supplementary_files_format_and_content: Gene-level counts calculated by FeatureCounts (.txt)
|
|
|
Submission date |
May 09, 2019 |
Last update date |
May 06, 2022 |
Contact name |
Eleonora Adami |
E-mail(s) |
[email protected]
|
Organization name |
Duke-NUS Medical School
|
Department |
CVMD
|
Street address |
8 College Road
|
City |
Singapore |
ZIP/Postal code |
169857 |
Country |
Singapore |
|
|
Platform ID |
GPL19057 |
Series (1) |
GSE130983 |
IL-11 is a therapeutic target in idiopathic pulmonary fibrosis |
|
Relations |
BioSample |
SAMN11613525 |
SRA |
SRX5814001 |