NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM3758271 Query DataSets for GSM3758271
Status Public on May 06, 2022
Title LONZA_NHLF3-IL11_S9
Sample type SRA
 
Source name Lung Fibroblasts (Commercial)
Organism Homo sapiens
Characteristics strain: NA
genotype: NA
treatment: IL11
rin: 8.8
Treatment protocol Normal human lung fibroblasts (Passage 3) were stimulated with 5ng/ml of recombinant human IL-11 for 24h
see above
Growth protocol see above
Extracted molecule polyA RNA
Extraction protocol Total RNA was extracted from either the snap-frozen liver tissues or HSCs lysate using Trizol (Invitrogen) followed by RNeasy column (Qiagen) purification.
Truseq Stranded mRNA (Poly A selection) kit
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina NextSeq 500
 
Description Normal human Lung fibroblasts IL11 (Commercial)
counts_human
Data processing Sequenced libraries were demultiplexed using bcl2fastq v2.19.0.316 with the --no-lane-splitting option
Adapter sequences were then trimmed using trimmomatic6 v0.36 in paired end mode with the options MAXINFO:35:0.5 MINLEN:35. For reference, the adapter sequences are: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA (read 1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read 2)
Trimmed reads were aligned to human genome hg38 or mouse genome mm10 using STAR v. 2.2.1 with the options --outFilterType BySJout --outFilterMultimapNmax 20 --alignSJoverhangMin 8 --alignSJDBoverhangMin 1 --outFilterMismatchNmax 999 --alignIntronMin 20 --alignIntronMax 1000000 --alignMatesGapMax 1000000 in paired end, single pass mode.
Only unique alignments were retained for counting. Counts were calculated at the gene level using the FeatureCounts module from subread v. 1.5.1, with the options -O -s 2 -J -T 8 -p -R -G.
Genome_build: Homo sapiens hg38 Ensembl release 92 and Mus musculus mm10 Ensembl release 86
Supplementary_files_format_and_content: Gene-level counts calculated by FeatureCounts (.txt)
 
Submission date May 09, 2019
Last update date May 06, 2022
Contact name Eleonora Adami
E-mail(s) [email protected]
Organization name Duke-NUS Medical School
Department CVMD
Street address 8 College Road
City Singapore
ZIP/Postal code 169857
Country Singapore
 
Platform ID GPL18573
Series (1)
GSE130983 IL-11 is a therapeutic target in idiopathic pulmonary fibrosis
Relations
BioSample SAMN11613537
SRA SRX5814021

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap