NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM4724300 Query DataSets for GSM4724300
Status Public on May 26, 2021
Title DK1-1: DLD1 KMT2A KO-1 rep1 RNAseq
Sample type SRA
 
Source name Colon carcinoma
Organism Homo sapiens
Characteristics cell line: DLD1 colorectal cancer cell line
crispr knockout: KMT2A knockout
sgrna sequence: TACCTGCAGAAGCAAGCTAA
Growth protocol Cells were cultured as adherent monolayers in Dulbecco’s Modified Eagle’s Medium (DMEM) (Sigma-Aldrich #D5796) supplemented with 10% (v/v) fetal bovine serum (Bovogen #SFBS-AU), 2mM L-glutamine (Life technologies #25030081), 100 units/mL penicillin and 0.1% (w/v) streptomycin (Life technologies #15140122) (complete DMEM, C-DMEM). Cells were grown at 37°C in a 5% CO2 humidified incubator, and passaged every 2-3 days (30-80% confluency).
Extracted molecule total RNA
Extraction protocol Total RNA was isolated using RNeasy Mini Kit (Qiagen,#74106) following manufacturer’s instructions.
100bp Paired end
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model BGISEQ-500
 
Data processing Basecalling using BGI
Alignment using STAR 2.5.2
Using Featurecounts function (Subread 1.6.3) to generate counts file based on Gencode v90 annotation
Genome_build: hg38
Supplementary_files_format_and_content: Gene level counts
 
Submission date Aug 12, 2020
Last update date May 26, 2021
Contact name Ron Firestein
E-mail(s) [email protected]
Organization name Hudson Institute of Medical Research
Department CCR
Lab Functional Genomics
Street address 21 Wright street
City Clayton
State/province VIC
ZIP/Postal code 3168
Country Australia
 
Platform ID GPL23227
Series (2)
GSE156082 Genome-scale CRISPR-Cas9 screen of Wnt/β-catenin signalling identifies therapeutic targets for Colorectal Cancer (RNA-seq)
GSE156083 Genome-scale CRISPR-Cas9 screen of Wnt/β-catenin signalling identifies therapeutic targets for Colorectal Cancer
Relations
BioSample SAMN15801100
SRA SRX8929149

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap