|
| Status |
Public on May 26, 2021 |
| Title |
DK13-1: DLD1 KMT2A KO-2 rep1 RNAseq |
| Sample type |
SRA |
| |
|
| Source name |
Colon carcinoma
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: DLD1 colorectal cancer cell line
crispr knockout: KMT2A knockout
sgrna sequence: TCAGAGTGCGAAGTCCCACA
|
| Growth protocol |
Cells were cultured as adherent monolayers in Dulbecco’s Modified Eagle’s Medium (DMEM) (Sigma-Aldrich #D5796) supplemented with 10% (v/v) fetal bovine serum (Bovogen #SFBS-AU), 2mM L-glutamine (Life technologies #25030081), 100 units/mL penicillin and 0.1% (w/v) streptomycin (Life technologies #15140122) (complete DMEM, C-DMEM). Cells were grown at 37°C in a 5% CO2 humidified incubator, and passaged every 2-3 days (30-80% confluency).
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was isolated using RNeasy Mini Kit (Qiagen,#74106) following manufacturer’s instructions.
100bp Paired end
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
BGISEQ-500 |
| |
|
| Data processing |
Basecalling using BGI
Alignment using STAR 2.5.2
Using Featurecounts function (Subread 1.6.3) to generate counts file based on Gencode v90 annotation
Genome_build: hg38
Supplementary_files_format_and_content: Gene level counts
|
| |
|
| Submission date |
Aug 12, 2020 |
| Last update date |
May 26, 2021 |
| Contact name |
Ron Firestein |
| E-mail(s) |
[email protected]
|
| Organization name |
Hudson Institute of Medical Research
|
| Department |
CCR
|
| Lab |
Functional Genomics
|
| Street address |
21 Wright street
|
| City |
Clayton |
| State/province |
VIC |
| ZIP/Postal code |
3168 |
| Country |
Australia |
| |
|
| Platform ID |
GPL23227 |
| Series (2) |
| GSE156082 |
Genome-scale CRISPR-Cas9 screen of Wnt/β-catenin signalling identifies therapeutic targets for Colorectal Cancer (RNA-seq) |
| GSE156083 |
Genome-scale CRISPR-Cas9 screen of Wnt/β-catenin signalling identifies therapeutic targets for Colorectal Cancer |
|
| Relations |
| BioSample |
SAMN15801141 |
| SRA |
SRX8929152 |
