|
| Status |
Public on Feb 01, 2021 |
| Title |
ZAP-g3 knockout HFF, untreated, replicate 1 [ZAP-g3-untr-rep1] |
| Sample type |
SRA |
| |
|
| Source name |
ZAP-g3 knockout HFF, untreated
|
| Organism |
Homo sapiens |
| Characteristics |
cell type: Primary human foreskin fibroblasts (HFF) cells
genotype/variation: ZAP-g3 knockout
treatment: untreated
grna sequence forward: CACCGGCCGGGATCACCCGATCGG
grna sequence reverse: AAACCCGATCGGGTGATCCCGGCC
grna name: ZAP-g3
4su treatment: NA
cmv infection: no
harvesting timepoint: 0h
|
| Treatment protocol |
Cells were subjected to CMV infection and 4sU treatment as indicated
|
| Growth protocol |
Primary human foreskin fibroblasts (HFF-1) cells (ATCC SCRC-1041) were maintained in DMEM (high glucose) supplemented with 15% FCS, 1% P/S and 1% non‐essential amino acids (NEAA). Cells were cultured at 37°C and 7.5% CO2.
Knockouts of ZAP (ZC3HAV1) were done using CRISPR/Cas9, with components transduced by lentiviruses
|
| Extracted molecule |
polyA RNA |
| Extraction protocol |
NEBNext Ultra II Directional RNA Library Prep Kit for Illumina
adapter sequence: GATCGGAAGAGCACACGT
For RNA-sequencing, Cells were resuspended in Trizol (Invitrogen) and RNA extracted from Trizol.
RNA-sequencing libraries were constructed using commercial kits (New England Biolabs)
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 4000 |
| |
|
| Description |
RNAseq_ZAP191-KD-24hpi-rep1
processed data file:
RNAseq_hg19_readcounts.tsv
|
| Data processing |
For bulk RNA-sequencing, alignments were done using hisat2 (Kim et al, 2015)
Sequencing reads were aligned to the hg19 version of the human genome using standard parameter, using the Refseq gtf file downloaded from the UCSC genome browser.
Reads were then quantified using quasR (Gaidatzis et al, 2015) and the above mentioned gtf file, or the HCMV TB40/E annotation (accession number MF871618).
Differential expression and corresponding p-values were calculated using edgeR (McCarthy et al, 2012).
For 4sU sequencing, reads were mapped to a combined index of the human genome (Hg38 / Ensembl v90) and the HCMV genome (accession number KF297339.1) using STAR (v2.5.3a) with parameters --outFilterMismatchNmax 20 --outFilterScoreMinOverLread 0.3 --outFilterMatchNminOverLread 0.3 --alignEndsType Extend5pOfReads12 --outSAMattributes nM MD NH.
We used GRAND-SLAM (v2.0.5d) (Jurges et al., 2018) to estimate the new-to-total RNA ratios.
We only used the parts of the reads that were sequenced by both mates in a read pair (parameter -double) for the estimation.
New RNA was computed by multiplying total RNA with the maximum a posteriori estimate of the new-to-total RNA ratio.
For further analyses, we removed all cellular genes that had less than 10 transcripts per million transcripts (TPM) in more than 6 (cellular genes) or 2 (viral genes) samples.
To remove artefacts due to imprecise quantification, we furthermore removed all viral genes with less than 100 new reads. Log2 fold changes were estimated using PsiLFC (Erhard, 2018) with uninformative prior (corresponding to no pseudocounts).
Normalization factors were computed from total RNA such that the median log2 foldchange was 0 and applied to both total and new RNA.
Genome_build: hg19 and HCMV MF871618 (bulk RNA-seq); hg38 and HCMV KF297339.1 (4sU seq)
Supplementary_files_format_and_content: tab-separated values
|
| |
|
| Submission date |
Oct 22, 2020 |
| Last update date |
Feb 01, 2021 |
| Contact name |
Emanuel Wyler |
| E-mail(s) |
[email protected]
|
| Phone |
+49 30 9406 3009
|
| Organization name |
Max Delbrück Center for Molecular Medicine
|
| Department |
Berlin Institute for Medical Systems Biology
|
| Lab |
RNA Biology and Posttranscriptional Regulation
|
| Street address |
Robert Roessle Str 10
|
| City |
Berlin |
| ZIP/Postal code |
13125 |
| Country |
Germany |
| |
|
| Platform ID |
GPL20301 |
| Series (1) |
| GSE159853 |
The Zinc Finger Antiviral Protein ZAP Restricts Human Cytomegalovirus and Selectively Binds and Destabilizes Viral UL4/UL5 Transcripts |
|
| Relations |
| BioSample |
SAMN16517024 |
| SRA |
SRX9344782 |
