 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jan 27, 2022 |
| Title |
MPRA E15.5 rep1 |
| Sample type |
SRA |
| |
|
| Source name |
Electroporated cells E15.5 somatosensory cortex
|
| Organism |
Mus musculus |
| Characteristics |
strain: C57BL/6
age: E15.5
celltype: mScarlet-I+
technique: MPRA
molecule subtype: RNA and DNA
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
The somatosensory cortex of in utero electroporated E15.5 mouse embryos was isolated and the electroporated area dissected. Single cell suspension was prepared using the papain-based neural dissociation kit (Miltenyi Biotec, Cat. N: 130-092-628) according to the manufacturer protocol with reduced dissociation times (5 min. instead of 15 min. at 37˚C). Cell number as well as the viability was assessed using the Countess™ II Automated Cell Counter (Invitrogen). Dissociated cells were and immediately FAC-sorted at a BD FACSAria Fusion (BD Bioscience) with four lasers (405, 488, 561, 640) using a 100µm nozzle. RNA and DNA were extracted from sorted cells using the Quick-DNA/RNA Microprep Plus Kit (Zymo Research; Cat. N: D7005). Purified RNA was treated with TURBO DNase (Thermo Fisher; Cat. N: AM1907) and reverse transcribed with Maxima H Minus RT (Thermo Fisher; Cat. N: EP0753) using Oligo(dT)18 Primer (Thermo Fisher; Cat. N: SO131). cDNA was purified with 1.5X vol. AMPure XP magnetic beads (Agencourt, Cat. N: A63881) and stored at -20 °C for later use.
Libraries from DNA and cDNA were prepared in the same way. Briefly, UMIs were added (98°C 30s; {98°C 10s, 65°C 30s, 72°C 1min} x3; 72°C 3min; Hold at 4°C) using the primers RV_univ_MPRA (CGACGCTCTTCCGATCT) and FWD_mScar_Tn7_10UMI_3 (0.5 µM each; GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG NNNNNNNNNN TCGACCGCAAGTTGGAC). P7 and P5 sequencing adapters were attached in two separate PCRs (98°C 30s; {98°C 10s, 65°C 90s} x(10+X); 72°C 5min; Hold at 4°C) using indexed Ad2.X(CAAGCAGAAGACGGCATACGAGAT XXXXXXXX GTCTCGTGGGCTCGGAGATGT) and P5NEXTPT5 primers (0.1 µM each; AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T). Required PCR cycle numbers were estimated by qPCR and using 1/10 of the second PCR product as input. All PCRs were performed in 1X NEBNext® Ultra™ II Q5® Master Mix (New England Biolabs; Cat. N: M0544), and PCR products were purified with 0.8X - 1.2X vol. of AMPure XP magnetic beads.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Description |
processed data: Compressed tarball archive containing DNA/RNA read counts and annotations for both replicates.
|
| Data processing |
library strategy: Targeted barcode amplification from RNA/DNA
50xbp paired-end reads from the DNA or RNA libraries were trimmed using cutadapt with the following parameters: -u 1 -a GAATTCTCATTAC -A TCGACCGCAAGTTGG --discard-untrimmed. Count tables for RNA and DNA reads were generated using MPRAflow (--bc-length 12 and –mpranalyze).
Genome_build: mm10
Supplementary_files_format_and_content: Compressed text file, containing pair-wise contact infomration in the medium juicer format (https://github.com/aidenlab/juicer/wiki/Pre) but omitting the read name: <str1> <chr1> <pos1> <frag1> <str2> <chr2> <pos2> <frag2> <mapq1> <mapq2>.
Supplementary_files_format_and_content: Bigwig files with CpG or GpC methylation levels of all cytosines covered by at last 5 reads (5x coverage).
Supplementary_files_format_and_content: Tab seperated table containing read counts per gene.
Supplementary_files_format_and_content: Compressed files contain sequences of selecred CREs (design.fa.gz), their annotation (labels.tsv.gz) and a pickle library with filtered CRE - Barcode associations (CRE_BC_association.pickle.gz).
Supplementary_files_format_and_content: Compressed tarball archive containing DNA/RNA read counts and annotations for both replicates.
|
| |
|
| Submission date |
Sep 16, 2021 |
| Last update date |
Jan 27, 2022 |
| Contact name |
Boyan Bonev |
| E-mail(s) |
[email protected]
|
| Organization name |
Helmholtz Zentrum München
|
| Lab |
Bonev Lab
|
| Street address |
Ingolstädter Landstr. 1
|
| City |
Neuherberg |
| State/province |
Deutschland |
| ZIP/Postal code |
85764 |
| Country |
Germany |
| |
|
| Platform ID |
GPL24247 |
| Series (1) |
| GSE155677 |
Multimodal profiling of the transcriptional regulatory landscape of the developing mouse cortex identifies Neurog2 as a key epigenome remodeler |
|
| Relations |
| BioSample |
SAMN21463018 |
| SRA |
SRX12214125 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM5583720_MPRA_pool_rep1_rep2.tar.gz |
3.1 Mb |
(ftp)(http) |
TAR |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
