|
| Status |
Public on May 16, 2022 |
| Title |
∆secB total translatome, rep2 |
| Sample type |
SRA |
| |
|
| Source name |
∆secB total translatome
|
| Organism |
Escherichia coli |
| Characteristics |
strain: W3110
genotype/variation: deltasecB::Kan SecA-Thrombin-Avi
treatment: untreated
|
| Treatment protocol |
The cells were harvested by rapid filtration, followed by flash freezing in liquid nitrogen. Frozen cells were mixed with 1 mL frozen Lysis Buffer and lysed by mixer milling (2 min, 25 Hz, Retsch). Frozen lysed cell powder was thawed in the presence of 20mM EDC. The crosslinking reaction was quenched with 20 mM glycine, 100 mM Tris pH 8.0, 4 mM NaHCO3.
|
| Growth protocol |
E. coli cells were grown in LB medium at 37 °C to an OD600 of 0.4 .
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Polysomes were digested with MNase (3750 U/1 mg RNA), purified through a sucrose cushion, and affinity purified via streptavidin magnetic beads . RNA from total monosomes and SecA-bound monosomes was extracted using Direct-zol kit. Ribosome-protected fragment were size selected and converted into a cDNA library for sequencing.
Libraries are prepared as described in (Mohammad and Buskirk, 2019) with modifications.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Data processing |
Library strategy: Ribo-Seq
Adaptor sequences (CTGTAGGCACCATCAATTCGTATGCCGTCTTCTGCTTG) were trimmed from sequencing reads using Cutadapt.
Ribosomal RNAs reads were removed by alignment using Bowtie.
Remaining reads were mapped to bacterial genome using Bowtie.
Ribosome density was assigned to 14-nt upstream of the 3’-end of reads using reads with size range 15–45 nt
Genome_build: ASM1024v1
Supplementary_files_format_and_content: Tab-delimited text files include: Column1: strand; Column2: genomic position; Column3: normalizeds ribosome reads (RPM); Column4: counts of ribosome reads.
|
| |
|
| Submission date |
Oct 08, 2021 |
| Last update date |
May 17, 2022 |
| Contact name |
Zikun Zhu |
| E-mail(s) |
[email protected]
|
| Organization name |
California Institute of Technology
|
| Department |
CCE
|
| Lab |
Shan
|
| Street address |
1200 E California Blvd
|
| City |
Pasadena |
| State/province |
CA |
| ZIP/Postal code |
91125 |
| Country |
USA |
| |
|
| Platform ID |
GPL25368 |
| Series (1) |
| GSE185572 |
Ribosome profiling reveals multiple roles of SecA in cotranslational protein export |
|
| Relations |
| BioSample |
SAMN22162001 |
| SRA |
SRX12528953 |
