DNA was extracted by first homogenizing tissue in lysis buffer and incubating for 60 minutes followed by 3 phenol extractions and precipitation.
Label
Cy3,Cy5
Label protocol
Take 5ug of DNA template and place in a 0.2mL PCR tube and add 5uL of primer solution and bring volume up to 40uL with diH20, mix gently and quickly spin. Then place the tubes in thermal cycler at 100 C for 5 minutes, quickly spin and immediately place on ice for 5 minutes. After this add 6uL of Klenow Buffer, 4uL Cy3-dCTP and 4uL Cy5-dCTP, 2uL klenow fragment, 6uL dNTPs and 2uL diH2O in a total volume of 60uL. Mix by pipetting, quickly spin and incubate at 37 C for 2 hours in thermal cycler. After the incubation combine the labeled samples into one Eppendorf tube and add 50uL Human Cot-I DNA, 10uL yeast tRNA and 200uL low TE. Load this into a Microcon YM-30 filter and spin at 12,600 rcf for 10 minutes. Discard deep purple flow through and add 450uL low TE and spin again. Repeat this until flow through is clear and then invert filter into new tube and spin for 2 minutes. Transfer the sample into a new 0.2mL PCR tube and adjust volume to 10uL with low TE.
DNA was extracted by first homogenizing tissue in lysis buffer and incubating for 60 minutes followed by 3 phenol extractions and precipitation.
Label
Cy5,Cy3
Label protocol
Take 5ug of DNA template and place in a 0.2mL PCR tube and add 5uL of primer solution and bring volume up to 40uL with diH20, mix gently and quickly spin. Then place the tubes in thermal cycler at 100 C for 5 minutes, quickly spin and immediately place on ice for 5 minutes. After this add 6uL of Klenow Buffer, 4uL Cy3-dCTP and 4uL Cy5-dCTP, 2uL klenow fragment, 6uL dNTPs and 2uL diH2O in a total volume of 60uL. Mix by pipetting, quickly spin and incubate at 37 C for 2 hours in thermal cycler. After the incubation combine the labeled samples into one Eppendorf tube and add 50uL Human Cot-I DNA, 10uL yeast tRNA and 200uL low TE. Load this into a Microcon YM-30 filter and spin at 12,600 rcf for 10 minutes. Discard deep purple flow through and add 450uL low TE and spin again. Repeat this until flow through is clear and then invert filter into new tube and spin for 2 minutes. Transfer the sample into a new 0.2mL PCR tube and adjust volume to 10uL with low TE.
Hybridization protocol
The primary restriction endonuclease used is MspI. After the digestion the following linkers were ligated: MspI24mer CAGCATCGAGACTGAACGCAGCAG, and MspI12mer CGCTGCTGCGTT. The 12 mer is not phosphorylated and does not ligate. After ligation the material is cleaned by phenol chloroform, precipitated, centrifuged, and resuspended. The material is divided in two, half being digested by the endonuclease McrBC and the other half being mock digested according to specification by New England Biolabs. The digestion time is 3 hours. As few as four 250-μL tubes were used for each sample pair for amplification of the representation in a 100ul volume reaction. The cycle conditions were 95°C for 1 min, 72°C for 3 min, for 15 cycles, followed by a 10-min extension at 72°C. The contents of the tubes for each pair were pooled when completed. Representations were cleaned by phenol-chloroform extraction, precipitated, resuspended, and the concentration determined. Representations were run on a gel to check for content, the McrBC digested representation being approximately 100-150bp shorter on average than the mock. DNA was labeled as described with minor changes (Lucito, Healy et al. 2003). Briefly, 2μg of DNA template was placed (dissolved in TE at pH 8) in a 0.2-mL PCR tube. 5 μL of random nanomers (Sigma Genosys) were added brought up to 25 μL with dH2O, and mixed. The tubes were placed in Tetrad at 100°C for 5 min, then on ice for 5 min. To this 5 μL of NEB Buffer2, 5 μL of dNTPs (0.6nm dCTP, 1.2nm dATP, dTTP, dGTP), 5 μL of label (Cy3-dCTP or Cy5-dCTP) from GE Healthcare, 2 μL of NEB Klenow fragment, and 2 μL dH2O was added. Procedures for hybridization and washing were followed as reported previously (As previously reported Chen, S. et. al. Cancer Biol Ther. 2008 Nov;7(11):1793-802. PMID: 18836286 ) with the exception that the oven temperature for hybridization was increased to 50°C.
Scan protocol
Microarray Images were scanned on GenePix 4000B scanner and data extracted using Nimblescan software (Nimblegen Systems Inc).
Description
Genomic DNA was first digested with MspI and ligated with adaptors; for ch1 the sample was then subjected to McrBC treatment while mock treatment for ch2, both followed by PCR amplification. Then a dye (label) swap was performed on the split sample. Additional raw files for each labeliing are provided as .ftr files.
Data processing
For each probe, the geometric mean of the ratios (GeoMeanRatio) of McrBc and control treated samples were then calculated for each experiment and its associated dye swap. The GeoMeanRatios of all the samples in a dataset were then normalized using quantile normalization method (Bolstad, B.M., Irizarry, R.A., Astrand, M. and Speed, T.P. (2003) Bioinformatics, 19, 185-193).
