 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jul 17, 2024 |
| Title |
pup-4(om141)_sRNA-seq_rep3 |
| Sample type |
SRA |
| |
|
| Source name |
whole animal
|
| Organism |
Caenorhabditis elegans |
| Characteristics |
tissue: whole animal
cell line: NA
cell type: NA
genotype: pup-4(om141)
developmental stage: 1-day adult
gender: hermaphrodite
|
| Growth protocol |
1-day old adult hermaphrodites raised at 22°C
|
| Extracted molecule |
other |
| Extraction protocol |
RNA was isolated from whole animals using the TRIzol (Invitrogen) method.
Treated with RNA 5' polyphosphatase; libraries generated with NEBNext Small Library Prep Kit.
|
| |
|
| Library strategy |
ncRNA-Seq |
| Library source |
other |
| Library selection |
size fractionation |
| Instrument model |
Illumina MiSeq |
| |
|
| Description |
pup4_sRNA_rep3
|
| Data processing |
Read were trimmed and quality-controlled using cutadapt with the parameters ‘-a AGATCGGAAGAGCACACGTCTGAACTCCAGTC -q 20 -m 15 -M 26’. Mapping was performed with HISAT2 using the c_elegans.PRJNA13758.WS284.genomic.fa reference genome and sorted BAM files were used as input into smalldisco. miRNAs and piRNAs were extracted from c_elegans.PRJNA13758.WS272.canonical_geneset.gtf and the file was converted into a BED file using BEDOP’s gft2bed command. The sorted BAM files, BED reference, and c_elegans.PRJNA13758.WS284.genomic.fa reference were used as input for smalldisco’s tail function using the ‘--tails-all’ to map the reads as sense to strand for miRNAs and piRNAs. For siRNAs, the sorted BAM files and c_elegans.PRJNA13758.WS272.canonical_geneset.gtf reference were supplied for the sirna function (smalldisco) with the parameter ‘-f CDS’. The output of this was used as input with smalldisco’s tail function, along with the c_elegans.PRJNA13758.WS284.genomic.fa reference. Counts tables were imported into R and processed to produce a matrix that combines the miRNA, piRNA, and siRNA counts (regardless of tail type).
Assembly: C. elegans WS284
Supplementary files format and content: Total counts (not parsed by tail type or sRNA biotype) in a matrix
|
| |
|
| Submission date |
Jul 05, 2024 |
| Last update date |
Jul 17, 2024 |
| Contact name |
Eleanor Maine |
| E-mail(s) |
[email protected]
|
| Organization name |
Syracuse University
|
| Department |
Biology
|
| Street address |
107 College Place
|
| City |
Syracuse |
| State/province |
New York |
| ZIP/Postal code |
13210 |
| Country |
USA |
| |
|
| Platform ID |
GPL15716 |
| Series (1) |
| GSE271568 |
Sequencing experiments on poly(U) polymerase mutants in C. elegans [srna] |
|
| Relations |
| BioSample |
SAMN39507816 |
| SRA |
SRX23314843 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
|
|
|
|
 |
