|
| Status |
Public on Feb 01, 2012 |
| Title |
Ctrl_EBSS_3h |
| Sample type |
RNA |
| |
|
| Source name |
Cells transfected with siCtrl and cultured for 3 hrs in EBSS.
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: MiaPaCa2
|
| Treatment protocol |
siRNA transfection: MiaPaCa2 and Panc1 cells were plated at 70% confluence in 100 mm dishes. INTERFErin™ reagent (POLYPLUS transfection) was used to perform siRNA transfections according to the manufacturer’s protocol. Nupr1, RelA/p65, RelB and IER3 were knocked-down using 140 ng of specific siRNAs. Scrambled siRNA targeting no known gene sequence was used as negative control. The sequences of Nupr1-specific siRNA (siNupr1 r(GGAGGACCCAGGACAGGAU)dTdT and siNupr1#2 r(AGGUCGCACCAAGAGAGAA)dTdT were previously reported (51) and RelA/p65- r(GAUCAAUGGCUACACAGG)dTdT, RelB- (siRelB r(GGAUUUGCCGAAUUAACAA)dTdT and siRelB#2 r(CUGCGGAUUUGCCGAAUUAUU)dTdT and IER3 (siIER3 r(GGAAGGAGAGCGUCGUUAA)dTdT and siIER3#2 r(AAGGCUUCUCUUUCUGCUG)dTdT-specific siRNAs were from Qiagen.
|
| Growth protocol |
Cell culture and in vitro stress induction: MiaPaCa2 cells obtained from the American Type Culture Collection were maintained in DMEM medium (Invitrogen) supplemented with 10% FBS at 37°C with 5% CO2. Cells were at about 70% confluence for all experiments. To avoid additional stress, all media were warmed to 37°C, cells were washed twice with warm Phosphate Saline Buffer (PBS) before adding Earle’s Balanced Salt Solution (EBSS, Invitrogen), which is completely devoid of glucose, amino acids and growth factors.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was isolated by the Trizol (Gibco-BRL) procedure.
|
| Label |
Biotin
|
| Label protocol |
Total RNA (200 ng per sample) was labeled using the Affymetrix GeneChip® WT cDNA Synthesis and Amplification Kit protocol
|
| |
|
| Hybridization protocol |
Biotinilated cRNA was hybridized to the arrays as described by the manufacturer (Affymetrix, Santa Clara, CA). The cRNA hybridization cocktail was incubated overnight at 45°C while rotating in a hybridization oven. After 16 h of hybridization, the cocktail was removed and the arrays were washed and stained in an Affymetrix GeneChip fluidics station 450, according to the Affymetrix-recommended protocol(http://media.affymetrix.com/support/downloads/manuals/wt_sensetarget_label_manual.pdf.
|
| Scan protocol |
The arrays were scanned using the Affymetrix GCS 3000 7G and the Gene-Chip Operating Software (Affymetrix, Santa Clara, CA), to produce the intensity files.
|
| Description |
IJCtrlEBSS3h.CEL
|
| Data processing |
The background subtraction and normalization of probe set intensities was performed using the method of Robust Multiarray Analysis (RMA(, using the Limma microarray package AffylmGUI (Bioconductor)
Values in the matrix table are in log2.
|
| |
|
| Submission date |
Jan 31, 2012 |
| Last update date |
Feb 01, 2012 |
| Contact name |
Ezequiel L Calvo |
| E-mail(s) |
[email protected]
|
| Organization name |
CRCHUL
|
| Department |
Molecular Endocrinilogy
|
| Lab |
Microarrays
|
| Street address |
2705 Boul. Laurier
|
| City |
Quebec |
| State/province |
Quebec |
| ZIP/Postal code |
G1V 4G2 |
| Country |
Canada |
| |
|
| Platform ID |
GPL6244 |
| Series (1) |
| GSE35463 |
The chromatin protein Nupr1 regulates RelB-dependent NF-kB events necessary for pancreatic cancer development |
|
