|
| Status |
Public on Aug 21, 2012 |
| Title |
Control R1 |
| Sample type |
SRA |
| |
|
| Source name |
Ventral Tegmental Area
|
| Organism |
Mus musculus |
| Characteristics |
tissue: Ventral Tegmental Area
stress: Unstressed control
exposure time: 10 days
strain: C57BL/6J
gender: male
|
| Treatment protocol |
C57BL/6J male mice were exposed to either emotional stress, physical stress, or control for 10 days. 24 hr later, VTA punches were taken.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA is isolated by using Trizol reagent (Invitrogen, California) following the product instructions. Four micrograms of total RNA is then used for mRNA library construction with the Illumina mRNA sample prep kit (cat#RS-100-0801). In brief, the poly-A containing mRNA is purified using poly-T oligo-attached magnetic beads. The mRNA is then fragmented into small pieces and converted into cDNA. These cDNA fragments then go through an end repair process, the addition of a single ‘A’ base, and then ligation of the adapters. These products are then gel purified and enriched with PCR to create the final cDNA libraries.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Data processing |
Adapter sequences (AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG) were removed from RNA-seq data using Fastx tool. They were then processed using the Cufflinks (v1.0.3) pipeline to determine gene expression levels and detect differential genes.
The three *.diff files are differential gene lists from comparison between the three treatment conditions and control.
emo=Emotional
res=Resilient
sus=Susceptible
Genome Build:
C1.fpkm_tracking: mm9
|
| |
|
| Submission date |
Feb 22, 2012 |
| Last update date |
May 15, 2019 |
| Contact name |
Li Shen |
| E-mail(s) |
[email protected]
|
| Organization name |
Icahn School of Medicine at Mount Sinai
|
| Department |
Neuroscience
|
| Lab |
Shen
|
| Street address |
1425 Madison Ave
|
| City |
New York |
| State/province |
NY |
| ZIP/Postal code |
10029 |
| Country |
USA |
| |
|
| Platform ID |
GPL13112 |
| Series (1) |
| GSE36005 |
High throughput sequencing of the mouse transcriptome within the VTA following exposure to emotional stress. |
|
| Relations |
| SRA |
SRX121679 |
| BioSample |
SAMN00791652 |
