disease state: Control (no prostatic disease) sample type: plasma circulating DNA subject: Individual12
Extracted molecule
genomic DNA
Extraction protocol
cirDNA was isolated from 1 mL of plasma using glass columns (sample set 1; Vivantis, Selangor, Malaysia) and QIAamp DNA Blood Mini Kit (sample set 2; Qiagen, Hilden, Germany), according to manufacturers’ instructions. DNA samples extracted from white blood cells (WBC) of 20 individuals unrelated to this project were pooled and used as reference. Isolated DNA was pooled and sheared by sonication to 200-500 bp fragments. 50 ng of cirDNA and sonicated DNA from pooled WBC genomic DNA (reference sample) were blunted using T4 DNA polymerase (NEB, Pickering, ON) and universal adaptors were ligated by overnight incubation at 4°C with T4 ligase (NEB, Pickering, ON). Blunt universal adaptors were prepared by annealing two oligonucleotides (oligo 1: GCGGTGACCCGGGAGATCTGAATTC and oligo 2: GAATTCAGATC). Next, adaptor-ligated DNA was digested using a cocktail of DNA modification-sensitive restriction enzymes (HpaII, HinP1I and HpyCH4IV) (NEB, Pickering, ON), which do not cut when the corresponding restriction sites contain modified nucleotides, 5-mC or 5-hmC. Therefore, the subsequent PCR, with primers complementary to the adaptors, amplifies only the fragments bearing such modifications. The digestion product was amplified in 25 µL final volume under the following conditions: 1x PCR buffer (Sigma-Aldrich, Oakville, ON) 2.875 mM MgCl2 (Sigma-Aldrich, Oakville, ON), 275 µM aminoallyl dNTP mix (Ambion, Austin, TX), 1.6 µM oligo 1 and 25 units Taq DNA polymerase (NEB, Pickering, ON). The PCR program started with an initial extension at 72°C for 5 min followed by 24 cycles of denaturation at 95°C for 1 minute, annealing at 94°C for 40 seconds and elongation at 72°C for 2.5 minutes, with a final extension step at 72°C for 5 minutes. Amplification was checked by electrophoresis in agarose gels. PCR products were purified using the MinElute kit (Qiagen, Mississauga, ON) and quantified using a Nanodrop 2000.
Label
Cy3
Label protocol
1.5 μg of purified enriched modified cirDNA was labelled using Cy3 (GE Healthcare, Baie d’Urfe, QC) and blood DNA reference pool was labelled using Cy5 (GE Healthcare, Baie d’Urfe, QC), according to the protocol detailed in Schumacher et al, 2006 (Schumacher, A., et al. (2006). Microarray-based DNA methylation profiling: technology and applications. Nucleic acids research 34, 528-542.)
cell type: white blood cell sample type: white blood cell genomic DNA subject: pool of 20 individuals disease state: control
Extracted molecule
genomic DNA
Extraction protocol
cirDNA was isolated from 1 mL of plasma using glass columns (sample set 1; Vivantis, Selangor, Malaysia) and QIAamp DNA Blood Mini Kit (sample set 2; Qiagen, Hilden, Germany), according to manufacturers’ instructions. DNA samples extracted from white blood cells (WBC) of 20 individuals unrelated to this project were pooled and used as reference. Isolated DNA was pooled and sheared by sonication to 200-500 bp fragments. 50 ng of cirDNA and sonicated DNA from pooled WBC genomic DNA (reference sample) were blunted using T4 DNA polymerase (NEB, Pickering, ON) and universal adaptors were ligated by overnight incubation at 4°C with T4 ligase (NEB, Pickering, ON). Blunt universal adaptors were prepared by annealing two oligonucleotides (oligo 1: GCGGTGACCCGGGAGATCTGAATTC and oligo 2: GAATTCAGATC). Next, adaptor-ligated DNA was digested using a cocktail of DNA modification-sensitive restriction enzymes (HpaII, HinP1I and HpyCH4IV) (NEB, Pickering, ON), which do not cut when the corresponding restriction sites contain modified nucleotides, 5-mC or 5-hmC. Therefore, the subsequent PCR, with primers complementary to the adaptors, amplifies only the fragments bearing such modifications. The digestion product was amplified in 25 µL final volume under the following conditions: 1x PCR buffer (Sigma-Aldrich, Oakville, ON) 2.875 mM MgCl2 (Sigma-Aldrich, Oakville, ON), 275 µM aminoallyl dNTP mix (Ambion, Austin, TX), 1.6 µM oligo 1 and 25 units Taq DNA polymerase (NEB, Pickering, ON). The PCR program started with an initial extension at 72°C for 5 min followed by 24 cycles of denaturation at 95°C for 1 minute, annealing at 94°C for 40 seconds and elongation at 72°C for 2.5 minutes, with a final extension step at 72°C for 5 minutes. Amplification was checked by electrophoresis in agarose gels. PCR products were purified using the MinElute kit (Qiagen, Mississauga, ON) and quantified using a Nanodrop 2000.
Label
Cy5
Label protocol
1.5 μg of purified enriched modified cirDNA was labelled using Cy3 (GE Healthcare, Baie d’Urfe, QC) and blood DNA reference pool was labelled using Cy5 (GE Healthcare, Baie d’Urfe, QC), according to the protocol detailed in Schumacher et al, 2006 (Schumacher, A., et al. (2006). Microarray-based DNA methylation profiling: technology and applications. Nucleic acids research 34, 528-542.)
Hybridization protocol
Labelled samples were co-hybridized to the HCGI12k microarrays (UHN, Toronto, ON) containing 12,192 CpG rich clones, as previously described (Schumacher, A., et al. (2006). Microarray-based DNA methylation profiling: technology and applications. Nucleic acids research 34, 528-542.). For all patients and controls, two technical replicates were tested.
Scan protocol
Hybridized microarrays were scanned using the Axon 4000B scanner and signals were processed using the GenePix Pro software (v6.1.0.4).
Description
Control group - Patient 12 Rep.2
Data processing
Microarray data was pre-processed using a modified version of the Variance Stabilizing Normalization (VSN) method, using the vsn package (v3.20.0) (Huber, W.,et al. (2002). Variance stabilization applied to microarray data calibration and to the quantification of differential expression. Bioinformatics (Oxford, England) 18 Suppl 1, S96-104). Pre-processed data was then analyzed with spot-wise linear-model fitting followed by an empirical Bayes moderation of the standard error (Smyth, G.K. (2004). Linear models and empirical bayes methods for assessing differential expression in microarray experiments. Statistical applications in genetics and molecular biology 3, Article3). A false-discovery rate (FDR) adjustment for multiple-testing was used and q-values (FDR-adjusted p-values) were assigned (Storey, J.D., and Tibshirani, R. (2003). Statistical significance for genomewide studies. Proceedings of the National Academy of Sciences of the United States of America 100, 9440-9445).
Per-probe microarray signals relative to the reference pool (called M values) were calculated by subtracting (in log-space) the VSN normalized signal intensities corresponding to the target prepared using the cirDNA sample (Cy3 channel) and the target prepared from the blood reference pool (Cy5 channel).
