ProfileGDS878 / GATCCATGGGCTCGCAATGA
TitleMPSS analysis of BLK CL.4 and liver cells
OrganismMus musculus


BLK CL.4 liver total RNA nuclear RNA post-nuclear RNA total RNA nuclear RNA post-nuclear RNA GSM17228 GSM17241 GSM17242 GSM17243 GSM17244 GSM17245 88% 90% 88% 92% 91% 94% sort by cell type sort by protocol Gene Expression Profile
Graph caption help
SampleTitleValueRank
GSM17228BLK.CL4 (MoBC.29xx)15088
GSM17241BLK.CL4 (MoBC.31Nc)14290
GSM17242BLK.CL4 (MoBC.30PN)13888
GSM17243Mouse liver (MoLi.231x)32592
GSM17244mouse liver (MoLi.251N)13691
GSM17245mouse liver (MoLi.241P)31394