ProfileGDS878 / GATCCTGGCAACTCTGCCAT
TitleMPSS analysis of BLK CL.4 and liver cells
OrganismMus musculus


BLK CL.4 liver total RNA nuclear RNA post-nuclear RNA total RNA nuclear RNA post-nuclear RNA GSM17228 GSM17241 GSM17242 GSM17243 GSM17244 GSM17245 43% 44% 71% 60% 42% 63% sort by cell type sort by protocol Gene Expression Profile
Graph caption help
SampleTitleValueRank
GSM17228BLK.CL4 (MoBC.29xx)1843
GSM17241BLK.CL4 (MoBC.31Nc)1844
GSM17242BLK.CL4 (MoBC.30PN)5271
GSM17243Mouse liver (MoLi.231x)4260
GSM17244mouse liver (MoLi.251N)1142
GSM17245mouse liver (MoLi.241P)3463