ProfileGDS878 / GATCTCTACTGGCAGGCCAT
TitleMPSS analysis of BLK CL.4 and liver cells
OrganismMus musculus


BLK CL.4 liver total RNA nuclear RNA post-nuclear RNA total RNA nuclear RNA post-nuclear RNA GSM17228 GSM17241 GSM17242 GSM17243 GSM17244 GSM17245 96% 97% 97% 29% 45% 65% sort by cell type sort by protocol Gene Expression Profile
Graph caption help
SampleTitleValueRank
GSM17228BLK.CL4 (MoBC.29xx)44696
GSM17241BLK.CL4 (MoBC.31Nc)48797
GSM17242BLK.CL4 (MoBC.30PN)57897
GSM17243Mouse liver (MoLi.231x)1129
GSM17244mouse liver (MoLi.251N)1245
GSM17245mouse liver (MoLi.241P)3765