GEO Profile Links for Gene (Select 105120) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 16

Select item 625641801.

AI197445 - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: AI197445, expressed sequence AI197445

Organism:: Mus musculus

Reporter:: GPL6333, scl44420.3_285-S (ID_REF), GDS3621, AI197445 (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62564180

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 756547502.

AI197445 - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: AI197445, expressed sequence AI197445

Organism:: Mus musculus

Reporter:: GPL6481, 100450022 (ID_REF), GDS4002, AI197445 (ORF)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75654750

GEO DataSets Gene Chromosome neighbors

Select item 619637803.

AI197445 - Eset depletion effect on embryonic stem cell

Annotation:: AI197445, expressed sequence AI197445

Organism:: Mus musculus

Reporter:: GPL6333, scl44420.3_285-S (ID_REF), GDS3599, AI197445 (ORF)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61963780

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 978651544.

AI197445 - Atherosclerosis susceptibility model: macrophages

Annotation:: AI197445, expressed sequence AI197445

Organism:: Mus musculus

Reporter:: GPL9734, 100087584_TGI_at (ID_REF), GDS4527, AK048275

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97865154

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 971521545.

AI197445 - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: AI197445, expressed sequence AI197445

Organism:: Mus musculus

Reporter:: GPL9734, 100087584_TGI_at (ID_REF), GDS4495, AK048275

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97152154

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 643529546.

AI197445 - Hypertension model: aorta

Annotation:: AI197445, expressed sequence AI197445

Organism:: Mus musculus

Reporter:: GPL9734, 100087584_TGI_at (ID_REF), GDS3672, AK048275

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64352954

GEO DataSets Gene Chromosome neighbors

Select item 644717547.

AI197445 - Hypertension model: kidney

Annotation:: AI197445, expressed sequence AI197445

Organism:: Mus musculus

Reporter:: GPL9734, 100087584_TGI_at (ID_REF), GDS3675, AK048275

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64471754

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 74883868.

AI197445 - MPSS transcriptome analysis project

Annotation:: AI197445, expressed sequence AI197445

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGTCCTCCAGCCCTCT (ID_REF), GDS868, AK047765

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7488386

GEO DataSets Gene Chromosome neighbors

Select item 644321549.

AI197445 - Hypertension model: liver

Annotation:: AI197445, expressed sequence AI197445

Organism:: Mus musculus

Reporter:: GPL9734, 100087584_TGI_at (ID_REF), GDS3674, AK048275

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64432154

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 6439255410.

AI197445 - Hypertension model: heart

Annotation:: AI197445, expressed sequence AI197445

Organism:: Mus musculus

Reporter:: GPL9734, 100087584_TGI_at (ID_REF), GDS3673, AK048275

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64392554

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 12782745011.

AI197445 - Rhabdomyosarcoma model

Annotation:: AI197445, expressed sequence AI197445

Organism:: Mus musculus

Reporter:: GPL6481, 100450022 (ID_REF), GDS5527, AI197445 (ORF)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 127827450

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 465100112.

AI197445 - Large-scale analysis of the mouse transcriptome (GNF1M)

Annotation:: AI197445, Expressed sequence AI197445

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m26737_at (ID_REF), GDS592, AI197445

DataSet type:: Expression profiling by array, count, 122 samples

ID:: 4651001

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 9215130713.

AI197445 - CD-1 neuronal stem cell response to microRNA-128 mimic

Annotation:: AI197445, expressed sequence AI197445

Organism:: Mus musculus

Reporter:: GPL13455, XR_106825_at (ID_REF), GDS4415, XR_106825

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 92151307

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 9215035414.

AI197445 - CD-1 neuronal stem cell response to microRNA-128 mimic

Annotation:: AI197445, expressed sequence AI197445

Organism:: Mus musculus

Reporter:: GPL13455, XR_105584_at (ID_REF), GDS4415, XR_105584

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 92150354

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 762608615.

AI197445 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: AI197445, expressed sequence AI197445

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGTCCTCCAGCCCTCT (ID_REF), GDS878, AK047765

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7626086

GEO DataSets Gene Chromosome neighbors

Select item 3031750116.

AI197445 - Transgenic T-cell receptor model of tolerant CD8+ T cells

Annotation:: AI197445, Expressed sequence AI197445

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m26737_at (ID_REF), GDS2327, AI197445

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 30317501

GEO DataSets Gene Chromosome neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 105120) (16)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 16

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity