GEO Profile Links for Gene (Select 14950) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1000

<< First< Prev

Page of 50

Next >Last >>

Select item 1124937491.

H13 - Wnt4 mutation effect on female embryonic gonads

Annotation:: H13, histocompatibility 13

Organism:: Mus musculus

Reporter:: GPL3108, 3649 (ID_REF), GDS2574, AK019877

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 112493749

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 91800572.

H13 - Skeletal muscle response to voluntary running: time course

Annotation:: H13, histocompatibility 13

Organism:: Mus musculus

Reporter:: GPL254, 674 (ID_REF), GDS1019, AK012600

DataSet type:: Expression profiling by array, log ratio, 7 samples

ID:: 9180057

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 76674273.

H13 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: H13, histocompatibility 13

Organism:: Mus musculus

Reporter:: GPL1010, GATCGGACAGGCAGGGGATG (ID_REF), GDS878, BC034217

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7667427

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1123530184.

H13 - Embryonic fibroblast in vitro model of hypothermia: time course

Annotation:: H13, histocompatibility 13

Organism:: Mus musculus

Reporter:: GPL6246, 10477147 (ID_REF), GDS5092, NM_001159551, NM_001159552, NM_010376, AF483214, AF515662, BC034217, BC045195, BC056977, DQ168449, NM_001159553, AK131644, chr2:152669462-152706824 (SPOT ID)

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 112353018

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 569772265.

H13 - Vancomycin effect on the kidney: dose response

Annotation:: H13, histocompatibility 13

Organism:: Mus musculus

Reporter:: GPL1261, 1455631_at (ID_REF), GDS3435, 14950 (Gene ID), BQ175993

DataSet type:: Expression profiling by array, count, 48 samples

ID:: 56977226

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 126363946.

H13 - T cell anergy induction regulation by Egr-2 and Egr-3 (MG-U74A)

Annotation:: H13, histocompatibility 13

Organism:: Mus musculus

Reporter:: GPL81, 96117_r_at (ID_REF), GDS1336, 14950 (Gene ID), AI843732

DataSet type:: Expression profiling by array, count, 5 samples

ID:: 12636394

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 153428937.

H13 - Embryonal carcinoma cell line response to retinoic acid or trichostatin A

Annotation:: H13, histocompatibility 13

Organism:: Mus musculus

Reporter:: GPL81, 96116_at (ID_REF), GDS1512, 14950 (Gene ID), AW048017

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 15342893

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 787300068.

H13 - Human Epidermal Growth Factor Receptor 2-positive breast cancer MMTV-Her2/Neu murine model: primary and secondary mammary tumors

Annotation:: H13, histocompatibility 13

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2700292 (ID_REF), GDS4099, NM_010376

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 78730006

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1194216459.

H13 - Chronic, low level drug exposure effect on obese liver

Annotation:: H13, histocompatibility 13

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P655663 (ID_REF), GDS5258, NM_010376, A_52_P655663 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 119421645

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5344841810.

H13 - Fibroblast pseudopodia response to fibronectin

Annotation:: H13, histocompatibility 13

Organism:: Mus musculus

Reporter:: GPL1261, 1417287_at (ID_REF), GDS3288, 14950 (Gene ID), NM_010376

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 53448418

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1561745611.

H13 - Heat shock factor HSF1 null mutant fibroblast response to heat shock: time course

Annotation:: H13, Histocompatibility 13

Organism:: Mus musculus

Reporter:: GPL2727, 33087 (ID_REF), GDS1527, AV074538, 2210009K20 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 20 samples

ID:: 15617456

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5296339812.

H13 - Liver response to Pacific ciguatoxin-1: time course

Annotation:: H13, histocompatibility 13

Organism:: Mus musculus

Reporter:: GPL2872, 16998 (ID_REF), GDS3259, BC056977, A_52_P341161 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 9 samples

ID:: 52963398

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2686321813.

H13 - CH1 domain deletion, p300 and CBP heterozygous null mutant hypoxic fibroblasts response to trichostatin A

Annotation:: H13, histocompatibility 13

Organism:: Mus musculus

Reporter:: GPL1261, 1417287_at (ID_REF), GDS2162, 14950 (Gene ID), NM_010376

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 26863218

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2681671814.

H13 - CH1 domain deletion, p300 and CBP heterozygous null mutant fibroblasts response to hypoxia

Annotation:: H13, histocompatibility 13

Organism:: Mus musculus

Reporter:: GPL1261, 1417287_at (ID_REF), GDS2161, 14950 (Gene ID), NM_010376

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 26816718

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1809581815.

H13 - Self-renewing memory B cell

Annotation:: H13, histocompatibility 13

Organism:: Mus musculus

Reporter:: GPL1261, 1417287_at (ID_REF), GDS1695, 14950 (Gene ID), NM_010376

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 18095818

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4476889416.

H13 - Pancreatic development (MG-U74A)

Annotation:: H13, histocompatibility 13

Organism:: Mus musculus

Reporter:: GPL81, 96117_r_at (ID_REF), GDS2948, 14950 (Gene ID), AI843732

DataSet type:: Expression profiling by array, transformed count, 10 samples

ID:: 44768894

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4491731817.

H13 - Estrogen-related receptor beta mutation effect on the stria vascularis

Annotation:: H13, histocompatibility 13

Organism:: Mus musculus

Reporter:: GPL1261, 1417287_at (ID_REF), GDS2955, 14950 (Gene ID), NM_010376

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 44917318

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2022579418.

H13 - Lactating mammary gland response to diets with varying amounts of fat: time course

Annotation:: H13, histocompatibility 13

Organism:: Mus musculus

Reporter:: GPL81, 96117_r_at (ID_REF), GDS1805, 14950 (Gene ID), AI843732

DataSet type:: Expression profiling by array, count, 32 samples

ID:: 20225794

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 752972719.

H13 - MPSS transcriptome analysis project

Annotation:: H13, histocompatibility 13

Organism:: Mus musculus

Reporter:: GPL1010, GATCGGACAGGCAGGGGATG (ID_REF), GDS868, BC034217

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7529727

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 2222991820.

H13 - ErbB2/Neu and luteinizing hormone overexpression effect on the mammary gland: time course

Annotation:: H13, histocompatibility 13

Organism:: Mus musculus

Reporter:: GPL1261, 1417287_at (ID_REF), GDS1924, 14950 (Gene ID), NM_010376

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 22229918

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 50

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 14950) (1000)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1000

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity