GEO Profile Links for Gene (Select 216441) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 960

<< First< Prev

Page of 48

Next >Last >>

Select item 83829271.

Slc26a10 - Lacrimal gland and cornea burn: time course (SMCmou8400A)

Annotation:: Slc26a10, Solute carrier family 26, member 10

Organism:: Mus musculus

Reporter:: GPL1230, 10827 (ID_REF), GDS947, BG066196

DataSet type:: Expression profiling by array, log ratio, 46 samples

ID:: 8382927

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 728398842.

Slc26a10 - Spatial and temporal development of mammalian salivary glands

Annotation:: Slc26a10, solute carrier family 26, member 10

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P140881 (ID_REF), GDS3922, NM_177615, A_52_P140881 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 84 samples

ID:: 72839884

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 83744633.

Slc26a10 - Lacrimal gland and cornea burn: time course (SMCmou8400A)

Annotation:: Slc26a10, Solute carrier family 26, member 10

Organism:: Mus musculus

Reporter:: GPL1230, 2363 (ID_REF), GDS947, BG066196

DataSet type:: Expression profiling by array, log ratio, 46 samples

ID:: 8374463

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 75259954.

Slc26a10 - MPSS transcriptome analysis project

Annotation:: Slc26a10, solute carrier family 26, member 10

Organism:: Mus musculus

Reporter:: GPL1010, GATCTACCTTCTCTTGGCTC (ID_REF), GDS868, BC089587

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7525995

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 280091215.

Slc26a10 - Spinal cord and dorsal root ganglion

Annotation:: Slc26a10, solute carrier family 26, member 10

Organism:: Mus musculus

Reporter:: GPL1261, 1447115_at (ID_REF), GDS2209, 216441 (Gene ID), C78409

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 28009121

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1225805356.

Slc26a10 - Mitochondrial complex I inhibitor rotenone effect on primary cortical neurons: time course

Annotation:: Slc26a10, solute carrier family 26, member 10

Organism:: Mus musculus

Reporter:: GPL6103, ILMN_1257015 (ID_REF), GDS5341, NM_177615

DataSet type:: Expression profiling by array, transformed count, 13 samples

ID:: 122580535

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 715416847.

Slc26a10 - Interstrain differences in the liver effects of trichloroethylene

Annotation:: Slc26a10, solute carrier family 26, member 10

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P140881 (ID_REF), GDS3890, NM_177615, A_52_P140881 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 94 samples

ID:: 71541684

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 633250578.

Slc26a10 - Fasting effect on the liver

Annotation:: Slc26a10, Solute carrier family 26, member 10

Organism:: Mus musculus

Reporter:: GPL922, 4957 (ID_REF), GDS3642, C0339A10 (CLONE ID), A_65_P01590 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 63325057

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 874859319.

Slc26a10 - Iroquois homeobox Irx3 and Irx5 deletion effect on embryonic heart

Annotation:: Slc26a10, solute carrier family 26, member 10

Organism:: Mus musculus

Reporter:: GPL6246, 10373054 (ID_REF), GDS4317, NM_177615, XM_006513564, XM_006513566, XR_380388, BC089587, chr10:127171393-127180582 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 87485931

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8903232110.

Slc26a10 - Nitric oxide generator DETA-NONOate effect on in vitro neuronal injury model: time course

Annotation:: Slc26a10, solute carrier family 26, member 10

Organism:: Mus musculus

Reporter:: GPL1261, 1447115_at (ID_REF), GDS4408, 216441 (Gene ID), C78409

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 89032321

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2495835111.

Slc26a10 - Estren effect on the estrogen receptor alpha null uterus: time course

Annotation:: Slc26a10, solute carrier family 26, member 10

Organism:: Mus musculus

Reporter:: GPL891, 12951 (ID_REF), GDS2078, NM_177615, A_51_P357043 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 10 samples

ID:: 24958351

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7312843112.

Slc26a10 - Adrenergic stress effect on transcription factor GATA4 S105A mutants: heart ventricle

Annotation:: Slc26a10, solute carrier family 26, member 10

Organism:: Mus musculus

Reporter:: GPL6246, 10373054 (ID_REF), GDS3931, NM_177615, XM_006513564, XM_006513566, XR_380388, BC089587, chr10:127171393-127180582 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 73128431

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10642203113.

Slc26a10 - Histone deacetylase 3 deficiency effect on the heart

Annotation:: Slc26a10, solute carrier family 26, member 10

Organism:: Mus musculus

Reporter:: GPL6246, 10373054 (ID_REF), GDS4886, NM_177615, XM_006513564, XM_006513566, XR_380388, BC089587, chr10:127171393-127180582 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 106422031

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6437289214.

Slc26a10 - Hypertension model: heart

Annotation:: Slc26a10, solute carrier family 26, member 10

Organism:: Mus musculus

Reporter:: GPL9734, 100096385_TGI_at (ID_REF), GDS3673, BC089587

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64372892

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10910082115.

Slc26a10 - Tumor-infiltrating CD8 T cells silenced for negative regulators of T cells

Annotation:: Slc26a10, solute carrier family 26, member 10

Organism:: Mus musculus

Reporter:: GPL1261, 1447115_at (ID_REF), GDS4986, 216441 (Gene ID), C78409

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 109100821

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9453292116.

Slc26a10 - Tuberous sclerosis complex 1 deficient naïve CD4 and CD8 T cells

Annotation:: Slc26a10, Solute carrier family 26, member 10

Organism:: Mus musculus

Reporter:: GPL11180, 1447115_PM_at (ID_REF), GDS4572, C78409

DataSet type:: Expression profiling by array, transformed count, 10 samples

ID:: 94532921

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10253306017.

Slc26a10 - Maternal western-style high fat diet effect on liver of two-week-old offspring

Annotation:: Slc26a10, solute carrier family 26, member 10 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL11533, 10373054 (ID_REF), GDS4774, NM_177615, NM_008080, NM_027739, BC089587, chr10:126608449-126617638 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 27 samples

ID:: 102533060

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 12091848418.

Slc26a10 - T helper type 9 cells

Annotation:: Slc26a10, solute carrier family 26, member 10

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P140881 (ID_REF), GDS5291, NM_177615, A_52_P140881 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 120918484

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8960893119.

Slc26a10 - Lung epithelium response to fungal allergen Alternaria

Annotation:: Slc26a10, solute carrier family 26, member 10

Organism:: Mus musculus

Reporter:: GPL6246, 10373054 (ID_REF), GDS4423, NM_177615, XM_006513564, XM_006513566, XR_380388, BC089587, chr10:127171393-127180582 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 89608931

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12232683120.

Slc26a10 - Death receptor knockout effect on NEMO-deficient model of chronic liver disease

Annotation:: Slc26a10, solute carrier family 26, member 10

Organism:: Mus musculus

Reporter:: GPL6246, 10373054 (ID_REF), GDS5332, NM_177615, XM_006513564, XM_006513566, XR_380388, BC089587, chr10:127171393-127180582 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 11 samples

ID:: 122326831

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 48

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 216441) (960)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 960

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity