GEO Profile Links for Gene (Select 225443) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1000

<< First< Prev

Page of 50

Next >Last >>

Select item 415522621.

Gm94 - Cannabinoid receptor double knockout mutant response to contact allergen

Annotation:: Gm94, predicted gene 94

Organism:: Mus musculus

Reporter:: GPL1261, 1458367_at (ID_REF), GDS2820, 225443 (Gene ID), AV376030

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 41552262

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 972779622.

Gm94 - Transcription factor Nrf2 gain-of-function model: postnatal day 2.5 whole skin

Annotation:: Gm94, predicted gene 94

Organism:: Mus musculus

Reporter:: GPL1261, 1458367_at (ID_REF), GDS4498, 225443 (Gene ID), AV376030

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 97277962

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 308022623.

Gm94 - Interferon regulatory factor 6 null mutation effect on the skin

Annotation:: Gm94, predicted gene 94

Organism:: Mus musculus

Reporter:: GPL1261, 1458367_at (ID_REF), GDS2359, 225443 (Gene ID), AV376030

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 30802262

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 364625624.

Gm94 - Epithelial transcription factor Get-1 deficiency effect on embryonic skin

Annotation:: Gm94, predicted gene 94

Organism:: Mus musculus

Reporter:: GPL1261, 1458367_at (ID_REF), GDS2629, 225443 (Gene ID), AV376030

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 36462562

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 141931525.

Gm94 - Transcription factor p63 null mutation effect on skin (MG-U74B)

Annotation:: Gm94, predicted gene 94

Organism:: Mus musculus

Reporter:: GPL82, 164042_at (ID_REF), GDS1435, 225443 (Gene ID), AA530312

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 14193152

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1108513156.

Gm94 - Pristane-induced arthritis effect on AIRmax and AIRmin acute inflammation model: footpad

Annotation:: Gm94, predicted gene 94

Organism:: Mus musculus

Reporter:: GPL6246, 10458709 (ID_REF), GDS5052, NM_001033280, BC147098, BC147099, BC171995, chr18:43777196-43792878 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 110851315

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 503854627.

Gm94 - Transcription factor AP-2 gamma mutation effect on the embryonic skin

Annotation:: Gm94, predicted gene 94

Organism:: Mus musculus

Reporter:: GPL1261, 1458367_at (ID_REF), GDS3171, 225443 (Gene ID), AV376030

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 50385462

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 723478628.

Gm94 - Oral mucosal adaptive immune model: time course

Annotation:: Gm94, predicted gene 94

Organism:: Mus musculus

Reporter:: GPL1261, 1458367_at (ID_REF), GDS3909, 225443 (Gene ID), AV376030

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 72347862

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74863679.

Gm94 - MPSS transcriptome analysis project

Annotation:: Gm94, Predicted gene 94

Organism:: Mus musculus

Reporter:: GPL1010, GATCCAAAGACCTCAAGGCA (ID_REF), GDS868, CB321197

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7486367

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 11828681510.

Gm94 - Adam10 deficiency effect on the epidermis

Annotation:: Gm94, predicted gene 94

Organism:: Mus musculus

Reporter:: GPL6246, 10458709 (ID_REF), GDS5229, NM_001033280, BC147098, BC147099, BC171995, chr18:43777196-43792878 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 118286815

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4290826211.

Gm94 - Folate deficiency and arsenic effect on the skin

Annotation:: Gm94, predicted gene 94

Organism:: Mus musculus

Reporter:: GPL1261, 1458367_at (ID_REF), GDS2872, 225443 (Gene ID), AV376030

DataSet type:: Expression profiling by array, count, 24 samples

ID:: 42908262

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12242345612.

Gm94 - Anterior stomach vagotomy effect on INS-GAS gastric cancer model stomach: time course

Annotation:: Gm94, predicted gene 94

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2900502 (ID_REF), GDS5336, NM_001033280, GM94 (ORF)

DataSet type:: Expression profiling by array, transformed count, 32 samples

ID:: 122423456

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11077791513.

Gm94 - Pristane-induced arthritis effect on AIRmax high acute inflammation model: footpad

Annotation:: Gm94, predicted gene 94

Organism:: Mus musculus

Reporter:: GPL6246, 10458709 (ID_REF), GDS5050, NM_001033280, BC147098, BC147099, BC171995, chr18:43777196-43792878 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 110777915

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12242345514.

Gm94 - Anterior stomach vagotomy effect on INS-GAS gastric cancer model stomach: time course

Annotation:: Gm94, predicted gene 94

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1243054 (ID_REF), GDS5336, NM_001033280, GM94 (ORF)

DataSet type:: Expression profiling by array, transformed count, 32 samples

ID:: 122423455

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12020856215.

Gm94 - Alopecia areata model: skin

Annotation:: Gm94, predicted gene 94

Organism:: Mus musculus

Reporter:: GPL1261, 1458367_at (ID_REF), GDS5274, 225443 (Gene ID), AV376030

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 120208562

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 125805216.

Gm94 - Hyperoxic lung injury (U74Bv2)

Annotation:: Gm94, predicted gene 94

Organism:: Mus musculus

Reporter:: GPL82, 164042_at (ID_REF), GDS248, 225443 (Gene ID), AA530312

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 1258052

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6264136217.

Gm94 - Nrf2-deficient lung response to cigarette smoke: dose response and time course

Annotation:: Gm94, predicted gene 94

Organism:: Mus musculus

Reporter:: GPL1261, 1458367_at (ID_REF), GDS3622, 225443 (Gene ID), AV376030

DataSet type:: Expression profiling by array, transformed count, 110 samples

ID:: 62641362

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4552186218.

Gm94 - TGF-beta overexpression effect on the cornea

Annotation:: Gm94, predicted gene 94

Organism:: Mus musculus

Reporter:: GPL1261, 1458367_at (ID_REF), GDS2974, 225443 (Gene ID), AV376030

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 45521862

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10710226219.

Gm94 - Stearoyl-CoA desaturase-1 deficiency effect on the skin

Annotation:: Gm94, predicted gene 94

Organism:: Mus musculus

Reporter:: GPL1261, 1458367_at (ID_REF), GDS4910, 225443 (Gene ID), AV376030

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 107102262

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2020576220.

Gm94 - Age effect on hematopoietic stem cells

Annotation:: Gm94, predicted gene 94

Organism:: Mus musculus

Reporter:: GPL1261, 1458367_at (ID_REF), GDS1803, 225443 (Gene ID), AV376030

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 20205762

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 50

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 225443) (1000)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1000

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity