GEO Profile Links for Gene (Select 229715) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 3982

<< First< Prev

Page of 200

Next >Last >>

Select item 517974421.

Amigo1 - Interleukin-22 effect on colon cultures

Annotation:: Amigo1, adhesion molecule with Ig like domain 1

Organism:: Mus musculus

Reporter:: GPL2872, 9342 (ID_REF), GDS3226, NM_146137, A_52_P664593 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 6 samples

ID:: 51797442

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 172056572.

Amigo1 - RPE65 null mutant model of Leber's congenital amaurosis

Annotation:: Amigo1, adhesion molecule with Ig like domain 1

Organism:: Mus musculus

Reporter:: GPL1261, 1425851_a_at (ID_REF), GDS1647, 229715 (Gene ID), BC022907

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 17205657

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 529578013.

Amigo1 - Liver response to Pacific ciguatoxin-1: time course

Annotation:: Amigo1, adhesion molecule with Ig like domain 1

Organism:: Mus musculus

Reporter:: GPL2872, 11401 (ID_REF), GDS3259, NM_146137, A_51_P433834 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 9 samples

ID:: 52957801

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 618792174.

Amigo1 - Isoproterenol-induced cardiomyopathy and exercise-induced cardiac hypertrophy

Annotation:: Amigo1, adhesion molecule with Ig like domain 1

Organism:: Mus musculus

Reporter:: GPL1261, 1447811_s_at (ID_REF), GDS3596, 229715 (Gene ID), BB387182

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 61879217

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1066863685.

Amigo1 - SIRT1 deficiency effect on the brain

Annotation:: Amigo1, adhesion molecule with Ig like domain 1

Organism:: Mus musculus

Reporter:: GPL8321, 1427373_at (ID_REF), GDS4895, 229715 (Gene ID), BC010598

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 106686368

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 597712176.

Amigo1 - Skeletal muscle response to myostatin inhibition

Annotation:: Amigo1, adhesion molecule with Ig like domain 1

Organism:: Mus musculus

Reporter:: GPL1261, 1447811_s_at (ID_REF), GDS3526, 229715 (Gene ID), BB387182

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 59771217

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 632008177.

Amigo1 - Myostatin depletion effect on mature skeletal muscle

Annotation:: Amigo1, adhesion molecule with Ig like domain 1

Organism:: Mus musculus

Reporter:: GPL1261, 1447811_s_at (ID_REF), GDS3637, 229715 (Gene ID), BB387182

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 63200817

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 206707288.

Amigo1 - Adenovirus vector effect on complement system deficient mutant livers

Annotation:: Amigo1, adhesion molecule with Ig like domain 1

Organism:: Mus musculus

Reporter:: GPL3222, M200009677 (ID_REF), GDS1826, NM_146137, BC010598

DataSet type:: Expression profiling by array, log2 ratio, 29 samples

ID:: 20670728

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1139938179.

Amigo1 - Glycerol-induced and cardiotoxin-induced models of skeletal muscle regeneration: time course

Annotation:: Amigo1, adhesion molecule with Ig like domain 1

Organism:: Mus musculus

Reporter:: GPL1261, 1447811_s_at (ID_REF), GDS4924, 229715 (Gene ID), BB387182

DataSet type:: Expression profiling by array, count, 48 samples

ID:: 113993817

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9573091710.

Amigo1 - Cmah knockout effect on mdx model of Duchenne Muscular Dystrophy (DMD): skeletal muscle

Annotation:: Amigo1, adhesion molecule with Ig like domain 1

Organism:: Mus musculus

Reporter:: GPL1261, 1447811_s_at (ID_REF), GDS4200, 229715 (Gene ID), BB387182

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 95730917

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10237861711.

Amigo1 - Cmah knockout effect on mdx model of Duchenne Muscular Dystrophy (DMD): cardiac muscle

Annotation:: Amigo1, adhesion molecule with Ig like domain 1

Organism:: Mus musculus

Reporter:: GPL1261, 1447811_s_at (ID_REF), GDS4770, 229715 (Gene ID), BB387182

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 102378617

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11942191712.

Amigo1 - Chronic, low level drug exposure effect on obese liver

Annotation:: Amigo1, adhesion molecule with Ig like domain 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P664593 (ID_REF), GDS5258, NM_146137, A_52_P664593 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 119421917

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5976752313.

Amigo1 - Skeletal muscle response to myostatin inhibition

Annotation:: Amigo1, adhesion molecule with Ig like domain 1

Organism:: Mus musculus

Reporter:: GPL1261, 1444117_at (ID_REF), GDS3526, 229715 (Gene ID), AI849018

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 59767523

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5709041714.

Amigo1 - Aortic endothelial cell response to dominant negative PPAR gamma expression in vitro

Annotation:: Amigo1, adhesion molecule with Ig like domain 1

Organism:: Mus musculus

Reporter:: GPL1261, 1447811_s_at (ID_REF), GDS3440, 229715 (Gene ID), BB387182

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 57090417

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8359081515.

Amigo1 - Non-obese diabetic (NOD) and disease-resistant NOD.NOR-Chr4 models: splenic B cells

Annotation:: Amigo1, adhesion molecule with Ig like domain 1

Organism:: Mus musculus

Reporter:: GPL1261, 1459020_at (ID_REF), GDS4340, 229715 (Gene ID), BI134052

DataSet type:: Expression profiling by array, transformed count, 11 samples

ID:: 83590815

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1703321716.

Amigo1 - Nodose and dorsal root ganglia comparison (MG-430 2.0)

Annotation:: Amigo1, adhesion molecule with Ig like domain 1

Organism:: Mus musculus

Reporter:: GPL1261, 1447811_s_at (ID_REF), GDS1635, 229715 (Gene ID), BB387182

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 17033217

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9542821717.

Amigo1 - Aged, lupus-prone MRL/Faslpr model: splenic CD4 T cells

Annotation:: Amigo1, adhesion molecule with Ig like domain 1

Organism:: Mus musculus

Reporter:: GPL1261, 1447811_s_at (ID_REF), GDS4190, 229715 (Gene ID), BB387182

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 95428217

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6319712318.

Amigo1 - Myostatin depletion effect on mature skeletal muscle

Annotation:: Amigo1, adhesion molecule with Ig like domain 1

Organism:: Mus musculus

Reporter:: GPL1261, 1444117_at (ID_REF), GDS3637, 229715 (Gene ID), AI849018

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 63197123

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 752629719.

Amigo1 - MPSS transcriptome analysis project

Annotation:: Amigo1, adhesion molecule with Ig like domain 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCATTAGACCTTGGGA (ID_REF), GDS868, NM_001004293

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7526297

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7669771720.

Amigo1 - Rosiglitazone effect on streptozotocin-induced diabetic DBA/2J mice: perpheral sciatic nerve

Annotation:: Amigo1, adhesion molecule with Ig like domain 1

Organism:: Mus musculus

Reporter:: GPL1261, 1447811_s_at (ID_REF), GDS4036, 229715 (Gene ID), BB387182

DataSet type:: Expression profiling by array, count, 19 samples

ID:: 76697717

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 200

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 229715) (3982)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 3982

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity