GEO Profile Links for Gene (Select 319323) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 17

Select item 76127531.

Serpina1c - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Serpina1c, Serine (or cysteine) peptidase inhibitor, clade A, member 1C

Organism:: Mus musculus

Reporter:: GPL1010, GATCATAGTATGTCTTGATA (ID_REF), GDS878, CD240978

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7612753

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 75269052.

Serpina1c - MPSS transcriptome analysis project

Annotation:: Serpina1c, Serine (or cysteine) peptidase inhibitor, clade A, member 1C

Organism:: Mus musculus

Reporter:: GPL1010, GATCTACCACTTTTCCCACA (ID_REF), GDS868, BI331956

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7526905

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 76646053.

Serpina1c - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Serpina1c, Serine (or cysteine) peptidase inhibitor, clade A, member 1C

Organism:: Mus musculus

Reporter:: GPL1010, GATCTACCACTTTTCCCACA (ID_REF), GDS878, BI331956

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7664605

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 303086284.

B430119L08Rik - Transgenic T-cell receptor model of tolerant CD8+ T cells

Annotation:: B430119L08Rik, RIKEN cDNA B430119L08 gene

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m17864_at (ID_REF), GDS2327, B430119L08 (CLONE ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 30308628

GEO DataSets Gene Profile neighbors

Select item 75320835.

Serpina1c - MPSS transcriptome analysis project

Annotation:: Serpina1c, Serine (or cysteine) peptidase inhibitor, clade A, member 1C

Organism:: Mus musculus

Reporter:: GPL1010, GATCGAATGGCTTCTTCCAT (ID_REF), GDS868, BB645415

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7532083

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 129775216.

Serpina1c - Muscle response to low frequency electrical stimulation: time course

Annotation:: Serpina1c, Serine (or cysteine) peptidase inhibitor, clade A, member 1C

Organism:: Mus musculus

Reporter:: GPL1345, 7921 (ID_REF), GDS1357, BG793938

DataSet type:: Expression profiling by array, log10 ratio, 6 samples

ID:: 12977521

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74750537.

Serpina1c - MPSS transcriptome analysis project

Annotation:: Serpina1c, Serine (or cysteine) peptidase inhibitor, clade A, member 1C

Organism:: Mus musculus

Reporter:: GPL1010, GATCATAGTATGTCTTGATA (ID_REF), GDS868, CD240978

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7475053

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 46421288.

B430119L08Rik - Large-scale analysis of the mouse transcriptome (GNF1M)

Annotation:: B430119L08Rik, RIKEN cDNA B430119L08 gene

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m17864_at (ID_REF), GDS592, B430119L08 (CLONE ID)

DataSet type:: Expression profiling by array, count, 122 samples

ID:: 4642128

GEO DataSets Gene

Select item 643756159.

B430119L08Rik - Hypertension model: heart

Annotation:: B430119L08Rik, RIKEN cDNA B430119L08 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100100946_TGI_at (ID_REF), GDS3673, AK046594

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64375615

GEO DataSets Gene Profile neighbors

Select item 6256601910.

B430119L08Rik - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: B430119L08Rik, RIKEN cDNA B430119L08 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl0319323.3_52-S (ID_REF), GDS3621, B430119L08Rik (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62566019

GEO DataSets Gene Profile neighbors

Select item 6196561911.

B430119L08Rik - Eset depletion effect on embryonic stem cell

Annotation:: B430119L08Rik, RIKEN cDNA B430119L08 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl0319323.3_52-S (ID_REF), GDS3599, B430119L08Rik (ORF)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61965619

GEO DataSets Gene Profile neighbors

Select item 6445481512.

B430119L08Rik - Hypertension model: kidney

Annotation:: B430119L08Rik, RIKEN cDNA B430119L08 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100100946_TGI_at (ID_REF), GDS3675, AK046594

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64454815

GEO DataSets Gene Profile neighbors

Select item 6441521513.

B430119L08Rik - Hypertension model: liver

Annotation:: B430119L08Rik, RIKEN cDNA B430119L08 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100100946_TGI_at (ID_REF), GDS3674, AK046594

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64415215

GEO DataSets Gene Profile neighbors

Select item 6433601514.

B430119L08Rik - Hypertension model: aorta

Annotation:: B430119L08Rik, RIKEN cDNA B430119L08 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100100946_TGI_at (ID_REF), GDS3672, AK046594

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64336015

GEO DataSets Gene Profile neighbors

Select item 9784821515.

B430119L08Rik - Atherosclerosis susceptibility model: macrophages

Annotation:: B430119L08Rik, RIKEN cDNA B430119L08 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100100946_TGI_at (ID_REF), GDS4527, AK046594

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97848215

GEO DataSets Gene Profile neighbors

Select item 9713521516.

B430119L08Rik - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: B430119L08Rik, RIKEN cDNA B430119L08 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100100946_TGI_at (ID_REF), GDS4495, AK046594

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97135215

GEO DataSets Gene Profile neighbors

Select item 766978317.

Serpina1c - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Serpina1c, Serine (or cysteine) peptidase inhibitor, clade A, member 1C

Organism:: Mus musculus

Reporter:: GPL1010, GATCGAATGGCTTCTTCCAT (ID_REF), GDS878, BB645415

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7669783

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 319323) (17)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 17

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity