GEO Profile Links for Gene (Select 320812) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 27

<< First< Prev

Page of 2

Next >Last >>

Select item 441844621.

C230071I02Rik - Diethylstilbestrol effect on the prepubertal uterus: dose response

Annotation:: C230071I02Rik, RIKEN cDNA C230071I02 gene

Organism:: Mus musculus

Reporter:: GPL891, 18762 (ID_REF), GDS2924, AK082631, A_51_P201024 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 6 samples

ID:: 44184462

GEO DataSets Gene Profile neighbors

Select item 59680622.

C230071I02Rik - High fat diet effect on aorta: time course

Annotation:: C230071I02Rik, RIKEN cDNA C230071I02 gene

Organism:: Mus musculus

Reporter:: GPL891, 18762 (ID_REF), GDS735, AK082631, A_51_P201024 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 54 samples

ID:: 5968062

GEO DataSets Gene

Select item 249641623.

C230071I02Rik - Estren effect on the estrogen receptor alpha null uterus: time course

Annotation:: C230071I02Rik, RIKEN cDNA C230071I02 gene

Organism:: Mus musculus

Reporter:: GPL891, 18762 (ID_REF), GDS2078, AK082631, A_51_P201024 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 10 samples

ID:: 24964162

GEO DataSets Gene Profile neighbors

Select item 63413624.

C230071I02Rik - Typical and atypical antipsychotic drugs effect on brain

Annotation:: C230071I02Rik, RIKEN cDNA C230071I02 gene

Organism:: Mus musculus

Reporter:: GPL891, 18762 (ID_REF), GDS775, AK082631, A_51_P201024 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 4 samples

ID:: 6341362

GEO DataSets Gene Profile neighbors

Select item 279731625.

C230071I02Rik - Estradiol effect on the uterus: time course

Annotation:: C230071I02Rik, RIKEN cDNA C230071I02 gene

Organism:: Mus musculus

Reporter:: GPL891, 18762 (ID_REF), GDS2208, AK082631, A_51_P201024 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 10 samples

ID:: 27973162

GEO DataSets Gene Profile neighbors

Select item 74839416.

C230071I02Rik - MPSS transcriptome analysis project

Annotation:: C230071I02Rik, RIKEN cDNA C230071I02 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCAGAACTTGGAAGCT (ID_REF), GDS868, AK082631

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7483941

GEO DataSets Gene

Select item 971496217.

C230071I02Rik - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: C230071I02Rik, RIKEN cDNA C230071I02 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100088561_TGI_at (ID_REF), GDS4495, AK082631

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97149621

GEO DataSets Gene Profile neighbors

Select item 468017958.

C230071I02Rik - Dicer inactivation effect on the embryonic heart

Annotation:: C230071I02Rik, RIKEN cDNA C230071I02 gene

Organism:: Mus musculus

Reporter:: GPL5025, 4295 (ID_REF), GDS3033, AK082631

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 46801795

GEO DataSets Gene Profile neighbors

Select item 643504219.

C230071I02Rik - Hypertension model: aorta

Annotation:: C230071I02Rik, RIKEN cDNA C230071I02 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100088561_TGI_at (ID_REF), GDS3672, AK082631

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64350421

GEO DataSets Gene Profile neighbors

Select item 746578810.

C230071I02Rik - MPSS transcriptome analysis project

Annotation:: C230071I02Rik, RIKEN cDNA C230071I02 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCTTCACGTGCTGGACAC (ID_REF), GDS868, AK051493

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7465788

GEO DataSets Gene

Select item 464642311.

C230071I02Rik - Large-scale analysis of the mouse transcriptome (GNF1M)

Annotation:: C230071I02Rik, RIKEN cDNA C230071I02 gene

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m22159_at (ID_REF), GDS592, C230071I02 (CLONE ID)

DataSet type:: Expression profiling by array, count, 122 samples

ID:: 4646423

GEO DataSets Gene

Select item 9786262112.

C230071I02Rik - Atherosclerosis susceptibility model: macrophages

Annotation:: C230071I02Rik, RIKEN cDNA C230071I02 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100088561_TGI_at (ID_REF), GDS4527, AK082631

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97862621

GEO DataSets Gene Profile neighbors

Select item 1877089313.

C230071I02Rik - MicroRNA miR-122 antisense inhibition effect on livers

Annotation:: C230071I02Rik, RIKEN cDNA C230071I02 gene

Organism:: Mus musculus

Reporter:: GPL2897, 50005 (ID_REF), GDS1729, AK082631

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 18770893

GEO DataSets Gene Profile neighbors

Select item 4139849314.

C230071I02Rik - Nephronophthisis model

Annotation:: C230071I02Rik, RIKEN cDNA C230071I02 gene

Organism:: Mus musculus

Reporter:: GPL2897, 50005 (ID_REF), GDS2817, AK082631

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 41398493

GEO DataSets Gene Profile neighbors

Select item 6439002115.

C230071I02Rik - Hypertension model: heart

Annotation:: C230071I02Rik, RIKEN cDNA C230071I02 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100088561_TGI_at (ID_REF), GDS3673, AK082631

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64390021

GEO DataSets Gene Profile neighbors

Select item 1302596216.

C230071I02Rik - Conjugated linoleic acid delipidative effect on obese line: time course

Annotation:: C230071I02Rik, RIKEN cDNA C230071I02 gene

Organism:: Mus musculus

Reporter:: GPL891, 18762 (ID_REF), GDS1360, AK082631, A_51_P201024 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 13025962

GEO DataSets Gene Profile neighbors

Select item 6196754417.

C230071I02Rik - Eset depletion effect on embryonic stem cell

Annotation:: C230071I02Rik, RIKEN cDNA C230071I02 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl39916.1_647-S (ID_REF), GDS3599, C230071I02Rik (ORF)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61967544

GEO DataSets Gene Profile neighbors

Select item 5539446218.

C230071I02Rik - Heart failure progression model: non-infarcted ventricular tissue

Annotation:: C230071I02Rik, RIKEN cDNA C230071I02 gene

Organism:: Mus musculus

Reporter:: GPL891, 18762 (ID_REF), GDS3386, AK082631, A_51_P201024 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 20 samples

ID:: 55394462

GEO DataSets Gene Profile neighbors

Select item 2494086219.

C230071I02Rik - Estren effect on the uterus: time course

Annotation:: C230071I02Rik, RIKEN cDNA C230071I02 gene

Organism:: Mus musculus

Reporter:: GPL891, 18762 (ID_REF), GDS2077, AK082631, A_51_P201024 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 12 samples

ID:: 24940862

GEO DataSets Gene Profile neighbors

Select item 760348820.

C230071I02Rik - MPSS analysis of BLK CL.4 and liver cells

Annotation:: C230071I02Rik, RIKEN cDNA C230071I02 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCTTCACGTGCTGGACAC (ID_REF), GDS878, AK051493

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7603488

GEO DataSets Gene

<< First< Prev

Page of 2

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 320812) (27)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 27

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity