GEO Profile Links for Gene (Select 403174) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1035

<< First< Prev

Page of 52

Next >Last >>

Select item 32321681.

Msantd1 - Malaria resistance

Annotation:: Msantd1, Myb/SANT-like DNA-binding domain containing 1

Organism:: Mus musculus

Reporter:: GPL519, 6668 (ID_REF), GDS471, AU024060

DataSet type:: Expression profiling by array, log ratio, 14 samples

ID:: 3232168

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 83868092.

Msantd1 - Lacrimal gland and cornea burn: time course (SMCmou8400A)

Annotation:: Msantd1, Myb/SANT-like DNA-binding domain containing 1

Organism:: Mus musculus

Reporter:: GPL1230, 14709 (ID_REF), GDS947, AU024060

DataSet type:: Expression profiling by array, log ratio, 46 samples

ID:: 8386809

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 83783453.

Msantd1 - Lacrimal gland and cornea burn: time course (SMCmou8400A)

Annotation:: Msantd1, Myb/SANT-like DNA-binding domain containing 1

Organism:: Mus musculus

Reporter:: GPL1230, 6245 (ID_REF), GDS947, AU024060

DataSet type:: Expression profiling by array, log ratio, 46 samples

ID:: 8378345

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 451608884.

Msantd1 - Male and female thymi response to aging and caloric restriction (A)

Annotation:: Msantd1, Myb/SANT-like DNA-binding domain containing 1

Organism:: Mus musculus

Reporter:: GPL738, 2988 (ID_REF), GDS2961, AU024060

DataSet type:: Expression profiling by array, transformed count, 67 samples

ID:: 45160888

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1193863965.

Msantd1 - Chronic, low level drug exposure effect on obese liver

Annotation:: Msantd1, Myb/SANT-like DNA-binding domain containing 1

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P148744 (ID_REF), GDS5258, NM_207277, A_51_P148744 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 119386396

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 155994356.

Msantd1 - Heat shock factor HSF1 null mutant fibroblast response to heat shock: time course

Annotation:: Msantd1, Myb/SANT-like DNA-binding domain containing 1

Organism:: Mus musculus

Reporter:: GPL2727, 11840 (ID_REF), GDS1527, AU024060, J0444H02 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 20 samples

ID:: 15599435

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 130015327.

Msantd1 - Conjugated linoleic acid delipidative effect on obese line: time course (dye-swap)

Annotation:: Msantd1, Myb/SANT-like DNA-binding domain containing 1

Organism:: Mus musculus

Reporter:: GPL891, 17632 (ID_REF), GDS1359, NM_207277, A_51_P148744 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 13001532

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 728203968.

Msantd1 - Spatial and temporal development of mammalian salivary glands

Annotation:: Msantd1, Myb/SANT-like DNA-binding domain containing 1

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P148744 (ID_REF), GDS3922, NM_207277, A_51_P148744 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 84 samples

ID:: 72820396

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 954704379.

Msantd1 - NZM2410-derived lupus susceptibility locus Sle2c1: peritoneal cavity B cells

Annotation:: Msantd1, Myb/SANT-like DNA-binding domain containing 1

Organism:: Mus musculus

Reporter:: GPL1261, 1443531_at (ID_REF), GDS4191, 403174 (Gene ID), AU024060

DataSet type:: Expression profiling by array, transformed count, 16 samples

ID:: 95470437

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2800553710.

Msantd1 - Spinal cord and dorsal root ganglion

Annotation:: Msantd1, Myb/SANT-like DNA-binding domain containing 1

Organism:: Mus musculus

Reporter:: GPL1261, 1443531_at (ID_REF), GDS2209, 403174 (Gene ID), AU024060

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 28005537

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9179433811.

Msantd1 - Oxidative stress effect on ATF4 knockout embryonic neurons

Annotation:: Msantd1, Myb/SANT-like DNA-binding domain containing 1

Organism:: Mus musculus

Reporter:: GPL6100, 3170035 (ID_REF), GDS3311, NM_207277

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 91794338

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5696513712.

Msantd1 - Vancomycin effect on the kidney: dose response

Annotation:: Msantd1, Myb/SANT-like DNA-binding domain containing 1

Organism:: Mus musculus

Reporter:: GPL1261, 1443531_at (ID_REF), GDS3435, 403174 (Gene ID), AU024060

DataSet type:: Expression profiling by array, count, 48 samples

ID:: 56965137

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2841173713.

Msantd1 - Fetal male and female gonadal somatic support cells

Annotation:: Msantd1, Myb/SANT-like DNA-binding domain containing 1

Organism:: Mus musculus

Reporter:: GPL1261, 1443531_at (ID_REF), GDS2222, 403174 (Gene ID), AU024060

DataSet type:: Expression profiling by array, transformed count, 4 samples

ID:: 28411737

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 596693214.

Msantd1 - High fat diet effect on aorta: time course

Annotation:: Msantd1, Myb/SANT-like DNA-binding domain containing 1

Organism:: Mus musculus

Reporter:: GPL891, 17632 (ID_REF), GDS735, NM_207277, A_51_P148744 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 54 samples

ID:: 5966932

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 746388915.

Msantd1 - MPSS transcriptome analysis project

Annotation:: Msantd1, Myb/SANT-like DNA-binding domain containing 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCAGAGAACTTTGAAG (ID_REF), GDS868, BE946452

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7463889

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 6801092716.

Msantd1 - Snord116del mutant hypothalamus response to neonatal starvation

Annotation:: Msantd1, Myb/SANT-like DNA-binding domain containing 1

Organism:: Mus musculus

Reporter:: GPL6103, ILMN_1230498 (ID_REF), GDS3786, NM_207277

DataSet type:: Expression profiling by array, transformed count, 16 samples

ID:: 68010927

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4418333217.

Msantd1 - Diethylstilbestrol effect on the prepubertal uterus: dose response

Annotation:: Msantd1, Myb/SANT-like DNA-binding domain containing 1

Organism:: Mus musculus

Reporter:: GPL891, 17632 (ID_REF), GDS2924, NM_207277, A_51_P148744 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 6 samples

ID:: 44183332

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7357675218.

Msantd1 - Rho kinase inhibitor fasudil effect on forebrain astrocyte culture: time course

Annotation:: Msantd1, Myb/SANT-like DNA-binding domain containing 1

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_1230498 (ID_REF), GDS3944, NM_207277

DataSet type:: Expression profiling by array, transformed count, 32 samples

ID:: 73576752

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9230443719.

Msantd1 - Rough attenuated Brucella suis strain infection effect on macrophage cell line: time course

Annotation:: Msantd1, Myb/SANT-like DNA-binding domain containing 1

Organism:: Mus musculus

Reporter:: GPL1261, 1443531_at (ID_REF), GDS4432, 403174 (Gene ID), AU024060

DataSet type:: Expression profiling by array, count, 42 samples

ID:: 92304437

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7564812520.

Msantd1 - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Msantd1, Myb/SANT-like DNA-binding domain containing 1

Organism:: Mus musculus

Reporter:: GPL6481, 4260554 (ID_REF), GDS4002, NM_207277, A930005I04Rik (CLONE ID)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75648125

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 52

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 403174) (1035)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1035

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity