GEO Profile Links for Gene (Select 52915) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1618

<< First< Prev

Page of 81

Next >Last >>

Select item 569823301.

Zmiz2 - Vancomycin effect on the kidney: dose response

Annotation:: Zmiz2, zinc finger, MIZ-type containing 2

Organism:: Mus musculus

Reporter:: GPL1261, 1460739_at (ID_REF), GDS3435, 52915 (Gene ID), BQ174371

DataSet type:: Expression profiling by array, count, 48 samples

ID:: 56982330

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7995902.

Zmiz2 - Autoimmune disease mechanisms

Annotation:: Zmiz2, zinc finger, MIZ-type containing 2

Organism:: Mus musculus

Reporter:: GPL81, 102271_at (ID_REF), GDS167, 52915 (Gene ID), AW125462

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 799590

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 422392903.

Zmiz2 - Brain trauma model: time course (MG-U74A)

Annotation:: Zmiz2, zinc finger, MIZ-type containing 2

Organism:: Mus musculus

Reporter:: GPL81, 102271_at (ID_REF), GDS2850, 52915 (Gene ID), AW125462

DataSet type:: Expression profiling by array, count, 22 samples

ID:: 42239290

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 766320304.

Zmiz2 - Time course of diabetes-induced, anti-Interferon-γ injected NOD.Scid mice: pancreatic islets

Annotation:: Zmiz2, zinc finger, MIZ-type containing 2

Organism:: Mus musculus

Reporter:: GPL1261, 1460739_at (ID_REF), GDS4034, 52915 (Gene ID), BQ174371

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 76632030

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 250389905.

Zmiz2 - Age effect on the hippocampus

Annotation:: Zmiz2, zinc finger, MIZ-type containing 2

Organism:: Mus musculus

Reporter:: GPL81, 102271_at (ID_REF), GDS2082, 52915 (Gene ID), AW125462

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 25038990

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 214249326.

Zmiz2 - Integrin beta-6 deficiency model of emphysema: alveolar macrophage

Annotation:: Zmiz2, zinc finger, MIZ-type containing 2

Organism:: Mus musculus

Reporter:: GPL1792, M200000414 (ID_REF), GDS1874, AK010771

DataSet type:: Expression profiling by array, log ratio, 15 samples

ID:: 21424932

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 470846307.

Zmiz2 - Matrix metalloproteinase mutant airway epithelial cells response to Pseudomonas aeruginosa infection: time course

Annotation:: Zmiz2, zinc finger, MIZ-type containing 2

Organism:: Mus musculus

Reporter:: GPL1261, 1460739_at (ID_REF), GDS3040, 52915 (Gene ID), BQ174371

DataSet type:: Expression profiling by array, transformed count, 25 samples

ID:: 47084630

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 454777308.

Zmiz2 - Vitamin E supplementation effect on aged brain

Annotation:: Zmiz2, zinc finger, MIZ-type containing 2

Organism:: Mus musculus

Reporter:: GPL1261, 1460739_at (ID_REF), GDS2973, 52915 (Gene ID), BQ174371

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 45477730

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 75201679.

Zmiz2 - MPSS transcriptome analysis project

Annotation:: Zmiz2, zinc finger, MIZ-type containing 2

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTTCTGTTTCTGTTCC (ID_REF), GDS868, BC024081

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7520167

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 863669010.

Zmiz2 - Glycine receptor beta subunit mutant model for hyperekplexia

Annotation:: Zmiz2, zinc finger, MIZ-type containing 2

Organism:: Mus musculus

Reporter:: GPL81, 102271_at (ID_REF), GDS967, 52915 (Gene ID), AW125462

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 8636690

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8028159011.

Zmiz2 - Proteasomal inhibitor lactacystin effect on cortical neurons in vitro: time course (MG_U74Av2)

Annotation:: Zmiz2, zinc finger, MIZ-type containing 2

Organism:: Mus musculus

Reporter:: GPL81, 102271_at (ID_REF), GDS4140, 52915 (Gene ID), AW125462

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 80281590

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2540323012.

Zmiz2 - Septic CD4+ splenocytes

Annotation:: Zmiz2, zinc finger, MIZ-type containing 2

Organism:: Mus musculus

Reporter:: GPL1261, 1460739_at (ID_REF), GDS2092, 52915 (Gene ID), BQ174371

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 25403230

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2318089013.

Zmiz2 - Primary visual cortex response to visual input deprivation (MG-U74A)

Annotation:: Zmiz2, zinc finger, MIZ-type containing 2

Organism:: Mus musculus

Reporter:: GPL81, 102271_at (ID_REF), GDS1983, 52915 (Gene ID), AW125462

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 23180890

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1732139014.

Zmiz2 - Dendritic cell subpopulations: spleen (MG-U74A)

Annotation:: Zmiz2, zinc finger, MIZ-type containing 2

Organism:: Mus musculus

Reporter:: GPL81, 102271_at (ID_REF), GDS1654, 52915 (Gene ID), AW125462

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 17321390

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 230989015.

Zmiz2 - Dendritic cell subtypes

Annotation:: Zmiz2, zinc finger, MIZ-type containing 2

Organism:: Mus musculus

Reporter:: GPL81, 102271_at (ID_REF), GDS352, 52915 (Gene ID), AW125462

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 2309890

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1733429016.

Zmiz2 - Medullary thymic epithelial cells

Annotation:: Zmiz2, zinc finger, MIZ-type containing 2

Organism:: Mus musculus

Reporter:: GPL81, 102271_at (ID_REF), GDS1655, 52915 (Gene ID), AW125462

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 17334290

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 222239017.

Zmiz2 - Hypothalamus response to lipopolysaccharide and restraint stress

Annotation:: Zmiz2, zinc finger, MIZ-type containing 2

Organism:: Mus musculus

Reporter:: GPL81, 102271_at (ID_REF), GDS324, 52915 (Gene ID), AW125462

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 2222390

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 117199018.

Zmiz2 - Alveolar septation (U74Av2)

Annotation:: Zmiz2, zinc finger, MIZ-type containing 2

Organism:: Mus musculus

Reporter:: GPL81, 102271_at (ID_REF), GDS242, 52915 (Gene ID), AW125462

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 1171990

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8026897219.

Zmiz2 - Proteasomal inhibitor lactacystin effect on cortical neurons in vitro: time course (MG_U74A)

Annotation:: Zmiz2, zinc finger, MIZ-type containing 2

Organism:: Mus musculus

Reporter:: GPL32, 102271_at (ID_REF), GDS4138, 52915 (Gene ID), AW125462

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 80268972

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 96369020.

Zmiz2 - Contextual fear conditioning paradigm

Annotation:: Zmiz2, zinc finger, MIZ-type containing 2

Organism:: Mus musculus

Reporter:: GPL81, 102271_at (ID_REF), GDS200, 52915 (Gene ID), AW125462

DataSet type:: Expression profiling by array, count, 64 samples

ID:: 963690

GEO DataSets Gene Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 81

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 52915) (1618)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1618

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity